AnalyteName | AnalyteDescr | CASNumber | Group1 | Group2 | Group3 | Group4 | AnalyteType1 | AnalyteType2 | LastUpdateDate | Chemical Group A | Total of (Aldrin,Dieldrin,Endrin,Heptachlor,Heptachlor Epoxide,Chlorine,HCH, Endosulfan,Toxaphene) | 0 | Organics | Pesticides | | | | | 2016-05-20 |
[(Methylimino)dimethylidyne]di-2,4-xylidine, N,N'- | N,N'-[(Methylimino)dimethylidyne]di-2,4-xylidine (Amitraz) | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
[DAsp3]Microcystin-RR | [Deaspartic?acid3] Microcystin-RR | 0 | | | | | | | 2019-05-17 |
1,2-bis(2,4,6- tribromophenoxy)ethane | 1,2-bis(2,4,6- tribromophenoxy)ethane (BTBPE) | 37853591 | Organics | FlameRetardants | | | | | 2014-03-13 |
1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane | 1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (DBE-DBCH) | 3322938 | Organics | FlameRetardants | | | | | 2014-03-13 |
13C2-Perfluorooctanoic acid (PFOA) | 13C2-Perfluorooctanoic acid (PFOA) | 0 | | | | | | | 2020-12-02 |
13C3-HFPO-DA (Surrogate) | Surrogate: 13C3-Hexafluoropropylene oxide dimer acid | 13252136 | Organics | | | | | | 2022-07-22 |
13c8-Perfluorooctanesulfonic acid (PFOS) | 13c8-Perfluorooctanesulfonic acid (PFOS) | 0 | | | | | | | 2020-12-02 |
18a-Oleanane | 18a-Oleanane | 30759923 | Organics | Hopanes | | | | | 2014-01-28 |
2,2-bis(chloromethyl)propane-1,3-diyltetrakis(2-chloroethyl) bisphosphate | 2,2-bis(chloromethyl)propane-1,3-diyltetrakis(2-chloroethyl) bisphosphate (V6) | 38051104 | Organics | FlameRetardants | | | | | 2014-03-13 |
2,4,6-tribromophenyl allyl ether | 2,4,6-tribromophenyl allyl ether (ATE) | 3278895 | Organics | FlameRetardants | | | | | 2014-03-13 |
2-ethyl-1-hexyl-2,3,4,5-tetrabromobenzoate | 2-ethyl-1-hexyl-2,3,4,5-tetrabromobenzoate (EHTBB) | 183658277 | Organics | FlameRetardants | | | | | 2014-03-13 |
2-Ethylhexyl-diphenyl phosphate | 2-Ethylhexyl-diphenyl phosphate (EHDPP) | 1241947 | Organics | FlameRetardants | | | | | 2014-03-13 |
4-Aminophenylsulfonylcarbamic acid methyl ester, N- | N-(4-Aminophenyl)sulfonylcarbamic acid methyl ester (Asulam) | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
4-chloro-2-methylphenyl-N,N-dimethylmethanimidamide, N'- | N'-(4-chloro-2-methylphenyl)-N,N-dimethylmethanimidamide (Chlordimeform) | 6164983 | Organics | Pesticides | | | | | 2017-05-24 |
6-Pack Ring | 6-Pack Ring | 0 | Debris | Trash | Plastics | FoodService | | | 2014-11-04 |
Abamectin | Abamectin | 71751412 | Organics | Pesticides | | | | | 2019-06-13 |
Abnormality | Abnormality (%) | 0 | Toxicity | | | | | | 2007-07-27 |
Abundance | Abundance | 0 | Toxicity | | | | | | 2007-07-27 |
AccesstoWaterbody_BikePath | AccesstoWaterbody_BikePath | 0 | Habitat | Debris | | | | | 2014-11-04 |
AccesstoWaterbody_Fence | AccesstoWaterbody_Fence | 0 | Habitat | Debris | | | | | 2014-11-04 |
AccesstoWaterbody_HeavyVegetation | AccesstoWaterbody_HeavyVegetation | 0 | Habitat | Debris | | | | | 2014-11-04 |
AccesstoWaterbody_ParkingLot | AccesstoWaterbody_ParkingLot | 0 | Habitat | Debris | | | | | 2014-11-04 |
AccesstoWaterbody_PicnicArea | AccesstoWaterbody_PicnicArea | 0 | Habitat | Debris | | | | | 2014-11-04 |
AccesstoWaterbody_RestrictedAccessMaintenanceRoad | AccesstoWaterbody_RestrictedAccessMaintenanceRoad | 0 | Habitat | Debris | | | | | 2014-11-04 |
AccesstoWaterbody_Roadway | AccesstoWaterbody_Roadway | 0 | Habitat | Debris | | | | | 2014-11-04 |
AccesstoWaterbody_Walkway | AccesstoWaterbody_Walkway | 0 | Habitat | Debris | | | | | 2014-11-04 |
Accumulation | Accumulation using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Acenaphthene | Acenaphthene | 83329 | Organics | PAHs | SVOCs | LMW_PAH | | | 2007-07-27 |
Acenaphthene-d10(Surrogate) | Surrogate: Acenaphthene-d10 | 15067262 | Organics | PAHs | SVOCs | LMW_PAH | | | 2016-03-02 |
Acenaphthenes, C1- | C1-Acenaphthenes | 0 | Organics | PAHs | LMW_PAH | | | | 2018-07-24 |
Acenaphthylene | Acenaphthylene | 208968 | Organics | PAHs | SVOCs | LMW_PAH | | | 2007-07-27 |
Acenaphthylene-d10(Surrogate) | Surrogate: Acenaphthylene-d10 | 0 | | | | | | | 2019-04-23 |
Acenaphthylene-d8(Surrogate) | Surrogate: Acenaphthylene-d8 | 208968 | Organics | PAHs | | | | | 2016-03-02 |
Acesulfame potassium | Acesulfame potassium | 55589623 | | | | | | | 2021-05-07 |
Acetaminophen | Acetaminophen | 103902 | Organics | PPCPs | | | | | 2010-04-26 |
Acetaminophen(Surrogate) | Surrogate: Acetaminophen | 0 | Organics | | | | | | 2017-03-06 |
Acetaminophen-13C2-15N(Surrogate) | Surrogate: Acetaminophen-13C2-15N | 0 | Organics | PPCPs | | | | | 2016-03-02 |
Acetamiprid | Acetamiprid | 135410207 | Organics | Pesticides | Insecticides | | | | 2016-03-10 |
Acetamiprid-13C6(Surrogate) | Surrogate: Acetamiprid-13C6 | 0 | Organics | Pesticides | | | | | 2018-08-07 |
Acetamiprid-N-Desmethyl | Acetamiprid-N-Desmethyl | 190604923 | Organics | Pesticides | | | | | 2018-08-07 |
Acetone | Acetone | 67641 | Organics | VOCs | | | | | 2007-07-27 |
Acetophenone | Acetophenone | 98862 | Organics | | | | | | 2018-07-16 |
Acibenzolar-S-methyl | Acibenzolar-S-methyl | 135158542 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Acid Mine Drainage Extent | Acid Mine Drainage Extent | 0 | Habitat | | | | | | 2019-05-07 |
Acid Mine Drainage Intensity | Acid Mine Drainage Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Acid Mine Drainage Proximity | Acid Mine Drainage Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Acid Neutralizing Capacity | Acid Neutralizing Capacity (ANC) | 0 | Inorganics | Conventionals | | | | | 2012-09-13 |
Acid Volatile Sulfides | Acid Volatile Sulfides (AVS) | 0 | Inorganics | Conventionals | | | | | 2012-09-13 |
Acifluorfen | Acifluorfen | 50594666 | Organics | Herbicides | | | | | 2016-05-20 |
Acifluorfen Sodium | Acifluorfen Sodium | 62476599 | Organics | Pesticides | | | | | 2017-04-10 |
Acrinathrin | Acrinathrin | 0 | Organics | Pesticides | Pest-Pyrethroids | | | | 2019-09-26 |
Acrolein | Acrolein | 107028 | Organics | OrganochlorinePesticides | | | | | 2008-11-07 |
Acrylic fiber | Acrylic fiber, that can be grouped under plastic category | 0 | Microdebris | Anthropogenic | Plastics | Fiber | | | 2018-04-26 |
Acrylic Fiber Bundle | Acrylic Fiber Bundle | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Acrylic Film | Acrylic Film | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Acrylic Foam | Acrylic Foam | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Acrylic Fragment | Acrylic Fragment | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Acrylic Sphere | Acrylic Sphere | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Acrylonitrile | Acrylonitrile | 107131 | Organics | VOCs | | | | | 2014-01-29 |
Acrylonitrile Butadiene Styrene Fiber | Acrylonitrile butadiene styrene Fiber | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Acrylonitrile Butadiene Styrene Film | Acrylonitrile butadiene styrene Film | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Acrylonitrile Butadiene Styrene Fragment | Acrylonitrile butadiene styrene Fragment | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Aesthetic Condition | Aesthetic Condition | 0 | Habitat | Debris | | | | | 2014-11-04 |
AFDM_Algae | Ash Free Dry Mass primarily of Algae but other items may be weighed | 0 | Inorganics | Conventionals | | | Constituents | | 2011-10-26 |
Age | Age | 0 | Tissue | | | | | | 2009-08-20 |
Age Diversity and Natural Regeneration Metric | Metric assesses the age diversity and natural regeneration potential of woody species in the riparian and channel zones (excluding low-flow). | 0 | Habitat | | | | | | 2019-05-13 |
Age_Pond | Age (in years) of the pond if it is created | 0 | Habitat | | | | | | 2012-09-13 |
Agricultural Other Extent | Agricultural Other Extent | 0 | Habitat | | | | | | 2019-05-07 |
Agricultural Other Intensity | Agricultural Other Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Agricultural Other Proximity | Agricultural Other Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Agricultural Runoff Extent | Agricultural Runoff Extent | 0 | Habitat | | | | | | 2019-05-07 |
Agricultural Runoff Intensity | Agricultural Runoff Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Agricultural Runoff Proximity | Agricultural Runoff Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Air Traffic Extent | Air Traffic Extent | 0 | Habitat | | | | | | 2019-05-07 |
Air Traffic Intensity | Air Traffic Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Air Traffic Proximity | Air Traffic Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Alachlor | Alachlor (Lasso) | 15972608 | Organics | Herbicides | Endocrine Disruptors | | | | 2013-05-28 |
Alachlor ethanesulfonic acid | Alachlor ethanesulfonic acid (ESA) | 142363539 | Organics | Pesticides | | | | | 2017-04-10 |
Alachlor oxanilic acid | Alachlor oxanilic acid (OXA) | 0 | Organics | Pesticides | | | | | 2017-04-10 |
Albuterol | Albuterol | 18559949 | Organics | PPCPs | | | | | 2010-04-26 |
Albuterol-d3(Surrogate) | Surrogate: Albuterol-d3 | 0 | Organics | PPCPs | | | | | 2016-03-02 |
Aldicarb | Aldicarb | 116063 | Organics | Pesticides | Pest-Carbamates | Insecticides | | | 2007-07-27 |
Aldicarb Sulfone | Aldicarb Sulfone | 1646884 | Organics | Pesticides | Insecticides | Carbamates | | | 2014-01-28 |
Aldicarb Sulfoxide | Aldicarb Sulfoxide | 1646873 | Organics | Pesticides | Insecticides | Carbamates | | | 2014-01-28 |
Aldrin | Aldrin | 309002 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
Aldrin(Surrogate) | Surrogate: Aldrin | 309002 | Organics | Pesticides | | | | | 2016-03-02 |
Aldrin-13C12(IsoDilAnalogue) | Isotopic Dilution Analogue: Aldrin-13C12 | 0 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
Aldrin-13C12(Surrogate) | Surrogate: Aldrin-13C12 | 309002 | Organics | Pesticides | | | | | 2016-03-02 |
Algae | Algae for benthics | 0 | Habitat | | | | CollectionDevice | | 2008-12-04 |
Algae Cover | Percent of stream's water surface upstream of sample location estimated to be covered with algae | 0 | FieldObservations | Habitat | | | Constituents | | 2010-03-03 |
Algae-attached | Percent of substrate in wetted channel upstream of sample location estimated to be covered with Algae-attached | 0 | FieldObservations | Habitat | | | Constituents | | 2011-11-02 |
Algae-floating Mats | Percent of stream's water surface upstream of sample location estimated to be covered with Algae-floating Mats | 0 | FieldObservations | Habitat | | | Constituents | | 2013-06-02 |
Algal Growth Potential as Chlorophyll a | Algal Growth Potential as Chlorophyll a | 0 | WaterQualityMeasurements | Conventionals | | | | | 2018-02-07 |
Algal/Surface Mats/Benthic Algal Growth Extent | Algal/Surface Mats/Benthic Algal Growth Extent | 0 | Habitat | | | | | | 2019-05-07 |
Algal/Surface Mats/Benthic Algal Growth Intensity | Algal/Surface Mats/Benthic Algal Growth Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Algal/Surface Mats/Benthic Algal Growth Proximity | Algal/Surface Mats/Benthic Algal Growth Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Alkalinity as CaCO3 | Alkalinity as CaCO3 | 471341 | Inorganics | Conventionals | WaterQualityMeasurements | Habitat | | | 2009-08-20 |
Allethrin | Allethrin | 584792 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Alpha Linolenic Acid | Alpha Linolenic Acid | 0 | Organics | Omega Fatty Acid | | | | | 2012-09-12 |
Alprazolam | Alprazolam | 28981977 | Organics | PPCPs | | | | | 2010-04-26 |
Alprazolam-d5(Surrogate) | Surrogate: Alprazolam-d5 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Aluminum | Aluminum | 7429905 | Inorganics | TraceElements | Metals | | | | 2007-07-27 |
Aluminum Foil | Aluminum Foil | 0 | Debris | Trash | Non-Plastics | Metals | | | 2014-11-04 |
Aluminum Phosphide | Aluminum Phosphide (Phostoxin or Fumitoxin) | 0 | Inorganics | Pesticides | | | | | 2017-04-04 |
Aluminum, Organic Monomeric | Organic Monomeric Aluminum (Organic Reactive) | 0 | Inorganics | TraceElements | Metals | | | | 2013-05-21 |
Aluminum, Total Monomeric | Total Monomeric Aluminum (Organic + Inorganic Reactive) | 0 | Inorganics | TraceElements | Metals | | | | 2013-05-21 |
Aluminum/Steel Can | Aluminum/Steel Can | 0 | Debris | Trash | Non-Plastics | Metals | | | 2014-11-04 |
Ametryn | Ametryn | 834128 | Organics | Pesticides | Pest-Triazines | Herbicides | | | 2007-07-27 |
Amino-1,2,4-triazole, 3- | 3-Amino-1,2,4-triazole (Amitrole) | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Amino-2-chloro-4(ethylamino)-s-triazine, 6- | 6-Amino-2-chloro-4(ethylamino)-s-triazine (CEAT) | 0 | Organics | Pesticides | | | | | 2017-04-04 |
Aminocarb | Aminocarb | 2032599 | Organics | Pesticides | Pest-Carbamates | Insecticides | | | 2007-07-27 |
Aminopyralid | Aminopyralid | 150114719 | Organics | Herbicides | | | | | 2016-05-20 |
Aminopyridine, 4- | 4-Aminopyridine | 504245 | Organics | Pesticides | | | | | 2017-04-20 |
Amitriptyline | Amitriptyline | 50486 | Organics | PPCPs | | | | | 2010-04-26 |
Amitriptyline-d5(Surrogate) | Surrogate: Amitriptyline-d5 | 0 | Organics | PPCPs | | | | | 2016-03-02 |
Amitriptyline-d6(Surrogate) | Surrogate: Amitriptyline-d6 | 0 | Organics | PPCPs | | | | | 2018-01-18 |
Amlodipine | Amlodipine | 88150429 | Organics | PPCPs | | | | | 2010-04-26 |
Ammonia as N | Ammonia as N | 7664417 | Inorganics | Conventionals | Nutrients | | | | 2007-07-27 |
Ammonia as N, Unionized | Unionized Ammonia as N | 7664417 | Inorganics | Conventionals | Nutrients | | | | 2012-06-22 |
Ammonia as NH3 | Ammonia as NH3 | 7664417 | Inorganics | Conventionals | Nutrients | WaterQualityMeasurements | | | 2007-07-27 |
Ammonia as NH3, Unionized | Unionized Ammonia as NH3 | 7664417 | Inorganics | Conventionals | Nutrients | WaterQualityMeasurements | | | 2012-06-27 |
Ammonium as N | Ammonium as N (NH4) | 0 | Inorganics | Conventionals | Nutrients | | Constituents | | 2010-04-21 |
Ammonium Chloride | Ammonium Chloride | 0 | Inorganics | | | | | | 2018-04-12 |
Amoxicillin | Amoxicillin | 26787780 | | | | | | | 2018-08-20 |
AMPA | Aminomethyl Phosphonic Acid (AMPA) | 1066519 | Organics | Pesticides | Herbicides | | | | 2013-05-28 |
AMPA(Surrogate) | Surrogate: Aminomethyl Phosphonic Acid (AMPA) | 77521290 | Organics | Pesticides | | | | | 2016-05-20 |
Amphetamine | Amphetamine | 300629 | Organics | PPCPs | | | | | 2010-04-26 |
Amphetamine-d5(Surrogate) | Surrogate: Amphetamine-d5 | 0 | Organics | PPCPs | | | | | 2016-03-02 |
AnalysisWeight | Analysis weight of sample | 0 | Laboratory | Ancillary | | | | | 2014-02-05 |
Anatoxin-A | Anatoxin-A | 64285069 | Microbiological | Cyanotoxins | | | | | 2012-05-22 |
Andorostenedione | Andorostenedione | 63058 | | | | | | | 2021-05-07 |
Androstane, 5-alpha- | 5-alpha-Androstane | 438222 | Organics | PPCPs | | | | | 2014-01-28 |
Angling Pressure | Angling Pressure | 0 | Habitat | | | | | | 2009-08-20 |
Anilazine | Anilazine | 101053 | Organics | Pesticides | Fungicides | | | | 2016-10-25 |
Aniline | Aniline (Aminobenzene)(Phenylamine) | 0 | Organics | VOCs | | | | | 2016-05-20 |
Animal Burrows Extent | Animal Burrows Extent | 0 | Habitat | | | | | | 2019-05-07 |
Animal Burrows Intensity | Animal Burrows Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Animal Burrows Proximity | Animal Burrows Proximity | 0 | Habitat | | | | | | 2019-05-07 |
AnimalPresence | describes presence of animals which may include tracks, scat, sounds or physical presence | 0 | FieldObservations | Habitat | | | | | 2013-04-01 |
Anion-Cation Balance | Anion-Cation Balance | 0 | Inorganics | | | | | | 2017-03-29 |
AnoxicTransitionDepth | Depth of the oxic-anoxic transition zone, also called redox potential discontinuity | 0 | FieldObservations | Habitat | | | | | 2018-02-20 |
Antennal segment | Antennal segment (#) | 0 | Toxicity | | | | | | 2007-07-27 |
Anthracene | Anthracene | 120127 | Organics | PAHs | SVOCs | LMW_PAH | | | 2007-07-27 |
Anthracene-d10(Surrogate) | Surrogate: Anthracene-d10 | 0 | Organics | PAHs | | | | | 2016-03-02 |
Anthraquinone | Anthraquinone | 84651 | Organics | | | | | | 2018-07-16 |
Anthropogenic (cellulosic) fiber | Cellulosic fiber (Cotton, Rayon, Modal, or Lyocell), that can be grouped under cellulosic fiber and is dyed or dyed. | 0 | Microdebris | Anthropogenic | Natural Based | Fiber | | | 2018-04-26 |
Anthropogenic (cellulosic) Fiber Bundle | Anthropogenic (cellulosic) Fiber Bundle | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Anthropogenic (cellulosic) Film | Anthropogenic (cellulosic) Film | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Anthropogenic (cellulosic) Foam | Anthropogenic (cellulosic) Foam | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Anthropogenic (cellulosic) Fragment | Anthropogenic (cellulosic) Fragment | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Anthropogenic (cellulosic) Sphere | Anthropogenic (cellulosic) Sphere | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Anthropogenic (non-plastic) fragment | Fragment that is anthropogenic, confirmed as non-plastic including asphalt | 0 | Microdebris | Anthropogenic | | Fragment | | | 2018-04-26 |
Anthropogenic (plastic) fragment | Fragment that is anthropogenic, confirmed as plastic based on dye spectroscopy, but polymer type could not be identified | 0 | Microdebris | Anthropogenic | Plastics | Fragment | | | 2018-04-26 |
Anthropogenic (protein base) Fiber | Anthropogenic (protein base) Fiber | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Anthropogenic (protein) fiber | Wool, hair, or silk fiber that can be grouped under protein fiber and is dyed or undyed | 0 | Microdebris | Anthropogenic | Natural Based | Fiber | | | 2018-04-26 |
Anthropogenic (synthetic) fiber | Synthetic fiber that is dyed (e.g. monomers, polymer degradation products such as aromatic compounds and esters) | 0 | Microdebris | Anthropogenic | | Fiber | | | 2018-06-18 |
Anthropogenic (synthetic) Film | Anthropogenic (synthetic) Film | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Anthropogenic (synthetic) Foam | Anthropogenic (synthetic) Foam | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Anthropogenic (synthetic) Fragment | Anthropogenic (synthetic) Fragment | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Anthropogenic (synthetic) Sphere | Anthropogenic (synthetic) Sphere | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Anthropogenic (unknown base) fiber | Fiber that is anthropogenic because it is DYED, but material type could not be identified as plastic or natural | 0 | Microdebris | Anthropogenic | | Fiber | | | 2018-06-18 |
Anthropogenic (unknown base) Fiber Bundle | Anthropogenic (unknown base) Fiber Bundle | 0 | Microdebris | Anthropogenic | Unknown | | | | 1900-01-01 |
Anthropogenic (unknown base) Film | Anthropogenic (unknown base) Film | 0 | Microdebris | Anthropogenic | Unknown | | | | 1900-01-01 |
Anthropogenic (unknown base) Foam | Anthropogenic (unknown base) Foam | 0 | Microdebris | Anthropogenic | Unknown | | | | 1900-01-01 |
Anthropogenic (unknown base) fragment | Fragment that is anthropogenic, confirmed as plastic , but polymer type could not be identified | 0 | Microdebris | Anthropogenic | Plastics | Fragment | | | 2018-04-26 |
Anthropogenic (unknown base) Sphere | Anthropogenic (unknown base) Sphere | 0 | Microdebris | Anthropogenic | Unknown | | | | 1900-01-01 |
Anthropogenic Alt Channel Modification SubMetric | Metric assesses the impact of anthropogenic alterations based on channel modification | 0 | Habitat | | | | | | 2019-05-13 |
Anthropogenic Alt Hydromodification SubMetric | Metric assesses the impact of anthropogenic alterations based on hydromodification and Channel Evolution Models (CEMS) | 0 | Habitat | | | | | | 2019-05-13 |
Anthropogenic Alterations to Channel Morph Metric | Metric assesses the impact of anthropogenic alterations to channel morphology through hydromodification and channel modification. Metric is an average of the two previous submetrics. | 0 | Habitat | | | | | | 2019-05-13 |
Antimony | Antimony | 7440360 | Inorganics | Metals | Metalloids | | | | 2007-07-27 |
Antipyrine | Antipyrine (Phenazone) | 60800 | | | | | | | 2021-05-07 |
Appliance | Appliance | 0 | Debris | Trash | Non-Plastics | Large | | | 2014-11-04 |
AquaticLife | AquaticLife using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Arachidonic | Arachidonic | 0 | Organics | Omega Fatty Acid | | | | | 2012-09-12 |
Area | Area | 0 | Tissue | Habitat | | | CollectionDevice | | 2012-06-01 |
Arsenate | Arsenate | 0 | Inorganics | Metals | | | | | 2014-01-29 |
Arsenic | Arsenic | 7440382 | Inorganics | TraceElements | Metals | Metalloids | | | 2007-07-27 |
Arsenic, Inorganic | Inorganic Arsenic | 7440382 | Inorganics | TraceElements | Metals | | | | 2013-05-28 |
Arsenite | Arsenite | 0 | Inorganics | Metals | | | | | 2014-01-29 |
Asbestos, Total | Total Asbestos | 0 | Inorganics | Conventionals | | | | | 2012-09-13 |
ASCI_D | Score for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_cnt.spp.most.tol_pct_att | Percent of taxa attributed with tolerance value (QA metric) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_cnt.spp.most.tol_pred | Count of most tolerant algae taxa (predicted) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_cnt.spp.most.tol_raw | Count of most tolerant algae taxa (raw) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_cnt.spp.most.tol_scr | Count of most tolerant algae taxa (score) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_EpiRho.richness_pct_att | Percent of taxa attributed with genus (QA metric) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_EpiRho.richness_pred | Richness of Epithemia and Rhopalodia taxa (predicted) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_EpiRho.richness_raw | Richness of Epithemia and Rhopalodia taxa (raw) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_EpiRho.richness_scr | Richness of Epithemia and Rhopalodia taxa (score) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_NumberTaxa | Number of diatom taxa | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_prop.spp.IndicatorClass_TN_low_pct_att | Percent of taxa attributed with nitrogen indicator value (QA metric) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_prop.spp.IndicatorClass_TN_low_pred | Proportion low total nitrogen indicator taxa (predicted) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_prop.spp.IndicatorClass_TN_low_raw | Proportion low total nitrogen indicator taxa (raw) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_prop.spp.IndicatorClass_TN_low_scr | Proportion low total nitrogen indicator taxa (score) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_prop.spp.Planktonic_pct_att | Percent of taxa attributed with habitat value (QA metric) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_prop.spp.Planktonic_pred | Proportion planktonic taxa (predicted) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_prop.spp.Planktonic_raw | Proportion planktonic taxa (raw) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_prop.spp.Planktonic_scr | Proportion planktonic taxa (score) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_prop.spp.Trophic.E_pct_att | Percent of taxa attributed with trophic indicator value (QA metric) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_prop.spp.Trophic.E_pred | Proportion eutrophic taxa (predicted) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_prop.spp.Trophic.E_raw | Proportion eutrophic taxa (raw) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_prop.spp.Trophic.E_scr | Proportion eutrophic taxa (score) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_Salinity.BF.richness_pct_att | Percent of taxa attributed with salinity value (QA metric) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_Salinity.BF.richness_pred | Richness of brackish/freshwater taxa (predicted) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_Salinity.BF.richness_raw | Richness of brackish/freshwater taxa (raw) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_Salinity.BF.richness_scr | Richness of brackish/freshwater taxa (score) for the Diatom Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_D_ValveCount | Total number of diatom valves reported in the input data (i.e., sum of BAResult) | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H | Score for the Hybrid (diatom and soft-bodied algae) Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_cnt.spp.IndicatorClass_TP_high_pct_att | Percent of taxa attributed phosphorus indicator value (QA metric) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_cnt.spp.IndicatorClass_TP_high_pred | Count of high total phosphorus indicator taxa (predicted) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_cnt.spp.IndicatorClass_TP_high_raw | Count of high total phosphorus indicator taxa (raw) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_cnt.spp.IndicatorClass_TP_high_scr | Count of high total phosphorus indicator taxa (score) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_cnt.spp.most.tol_pct_att | Percent of taxa attributed with tolerance value (QA metric) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_cnt.spp.most.tol_pred | Count of most tolerant algae taxa (predicted) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_cnt.spp.most.tol_raw | Count of most tolerant algae taxa (raw) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_cnt.spp.most.tol_scr | Count of most tolerant algae taxa (score) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_EpiRho.richness_pct_att | Percent of taxa attributed with genus (QA metric) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_EpiRho.richness_pred | Richness of Epithemia and Rhopalodia taxa (predicted) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_EpiRho.richness_raw | Richness of Epithemia and Rhopalodia taxa (raw) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_EpiRho.richness_scr | Richness of Epithemia and Rhopalodia taxa (score) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_NumberTaxa | Number of diatom taxa + soft-bodied algae taxa in Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_OxyReD_DO_30.richness_pct_att | Percent of taxa attributed with oxygen tolerance value (QA metric) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_OxyReD_DO_30.richness_pred | Richness of algae species with 30% oxygen tolerance (predicted) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_OxyReD_DO_30.richness_raw | Richness of algae species with 30% oxygen tolerance (raw) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_OxyReD_DO_30.richness_scr | Richness of algae species with 30% oxygen tolerance (score) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_prop.spp.Planktonic_pct_att | Percent of taxa attributed with habitat value (QA metric) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_prop.spp.Planktonic_pred | Proportion planktonic algae taxa (predicted) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_prop.spp.Planktonic_raw | Proportion planktonic algae taxa (raw) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_prop.spp.Planktonic_scr | Proportion planktonic algae taxa (score) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_prop.spp.Trophic.E_pct_att | Percent of taxa attributed with trophic indicator value (QA metric) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_prop.spp.Trophic.E_pred | Proportion eutrophic algae taxa (predicted) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_prop.spp.Trophic.E_raw | Proportion eutrophic algae taxa (raw) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_prop.spp.Trophic.E_scr | Proportion eutrophic algae taxa (score) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_prop.spp.ZHR_pct_att | Proportion of taxa attributed for the Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa metric for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_prop.spp.ZHR_raw | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (raw) | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_prop.spp.ZHR_scr | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (score) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_Salinity.BF.richness_pct_att | Percent of taxa attributed with salinity value (QA metric) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_Salinity.BF.richness_pred | Richness of brackish/freshwater algae taxa (predicted) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_Salinity.BF.richness_raw | Richness of brackish/freshwater algae taxa (raw) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_H_Salinity.BF.richness_scr | Richness of brackish/freshwater algae taxa (score) for the Hybrid Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S | Score for the Soft-bodied Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_Biovolume | Total soft-bodied algae biovolume reported in the input data (i.e., sum of Result) | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_EntityCount | Total number of soft-bodied algae entities reported in the input data (i.e., sum of BAResult) | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_NumberTaxa | Number of soft-bodied algae taxa | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_prop.spp.IndicatorClass_DOC_high_pct_att | Percent of taxa attributed with dissolved organic carbon indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_prop.spp.IndicatorClass_DOC_high_raw | Proportion high dissolved organic carbon indicator Algal species (raw) | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_prop.spp.IndicatorClass_DOC_high_scr | Proportion high dissolved organic carbon indicator Algal species (score) for the Soft-bodied Agae Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_prop.spp.IndicatorClass_NonRef_pct_att | Percent of taxa attributed with reference/non-reference indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_prop.spp.IndicatorClass_NonRef_raw | Proportion non-reference indicator algae species (raw) for the Soft-bodied Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_prop.spp.IndicatorClass_NonRef_scr | Proportion non-reference indicator algae species (score) for the Soft-bodied Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_prop.spp.IndicatorClass_TP_high_pct_att | Percent of taxa attributed phosphorus indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_prop.spp.IndicatorClass_TP_high_raw | Proportion high total phosphorus indicator algae taxa (raw) for the Soft-bodied Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_prop.spp.IndicatorClass_TP_high_scr | Proportion high total phosphorus indicator Algal taxa (score) for the Soft-bodied Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_prop.spp.ZHR_pct_att | Proportion of taxa attributed for the Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa metric for the Soft-bodied Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_prop.spp.ZHR_raw | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (raw) for the Soft-bodied Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
ASCI_S_prop.spp.ZHR_scr | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (score) for the Soft-bodied Algal Stream Condition Index | 0 | Bioassessment | | | | | | 2021-01-28 |
Ash Free Dry Mass | Ash-Free Dry Mass (AFDM, AFDW) | 0 | Inorganics | Conventionals | Benthic | | Constituents | | 2011-11-10 |
Asphalt Fragment | Asphalt Fragment | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Aspon | Aspon | 3244904 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
AssemblageIDAlgaeSampleVolume | Volume of material and liquid to produce the soft algae assemblage (taxonomy) sample | 0 | Habitat | | | | | | 2009-10-29 |
AssemblageIDDiatomSampleVolume | Volume of material and liquid to produce the diatom assemblage (taxonomy) sample | 0 | Habitat | | | | | | 2009-10-29 |
Atenolol | Atenolol | 29122687 | Organics | PPCPs | | | | | 2010-04-26 |
Atenolol-d7(Surrogate) | Surrogate: Atenolol-d7 | 0 | Organics | PPCPs | | | | | 2016-03-02 |
Atorvastatin | Atorvastatin | 134523005 | Organics | PPCPs | | | | | 2010-04-26 |
Atraton | Atraton | 1610179 | Organics | Pesticides | Pest-Triazines | Herbicides | | | 2007-07-27 |
Atrazine | Atrazine | 1912249 | Organics | Pesticides | Pest-Triazines | Herbicides | | | 2007-07-27 |
Atrazine dealkylated | Atrazine dealkylated | 0 | Organics | Pesticides | | | | | 2017-04-10 |
Atrazine-13C3(Surrogate) | Surrogate: Atrazine-13C3 | 0 | Organics | Pesticides | Pest-Triazines | | | | 2016-03-02 |
Atrazine-d5(Surrogate) | Surrogate: Atrazine-d5 | 163165751 | Organics | Pesticides | Pest-Triazines | Herbicides | | | 2016-03-02 |
Atrazine-Desisopropyl-2-Hydroxy | Atrazine-Desisopropyl-2-Hydroxy | 7313544 | Organics | Omega Fatty Acid | | | | | 2012-09-12 |
ATVs Extent | ATVs Extent | 0 | Habitat | | | | | | 2019-05-07 |
ATVs Intensity | ATVs Intensity | 0 | Habitat | | | | | | 2019-05-07 |
ATVs Proximity | ATVs Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Autopart | Autopart | 0 | Debris | Trash | Non-Plastics | Metals | | | 2014-11-04 |
Avoidance | Avoidance (%) | 0 | Toxicity | | | | | | 2007-07-27 |
Azinphos Ethyl | Azinphos Ethyl | 2642719 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2013-05-28 |
Azinphos Methyl | Azinphos Methyl (Guthion) | 86500 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2013-05-28 |
Azinphos Methyl oxon | Azinphos Methyl oxon | 0 | Organics | Pesticides | | | | | 2018-03-04 |
Azinphos Methyl(Surrogate) | Surrogate: Azinphos Methyl | 0 | Organics | Pesticides | OrganophosphatePest. | Insecticides | | | 2016-03-02 |
Azinphos-methyl oxygen analog | Azinphos-methyl oxygen analog | 0 | Organics | Pesticides | | | | | 2017-04-10 |
Azithromycin | Azithromycin | 83905015 | Organics | PPCPs | | | | | 2010-04-26 |
Azobenzene | Azobenzene (Diphenyl Diimide) | 103333 | Organics | SVOCs | | | | | 2014-01-29 |
Azoxystrobin | Azoxystrobin | 131860338 | Pesticides | Fungicides | | | | | 2012-06-21 |
Back Water | Back Water present | 0 | Habitat | | | | | | 2009-08-20 |
Backscatter | Backscatter - CTD casts | 0 | WaterQualityMeasurements | Ancillary | | | | | 2014-02-05 |
Bacteriophage MS2 | Bacteriophage MS2 | 0 | Microbiological | Pathogens | | | | | 2020-09-03 |
Bacteroidales, Canine (DogBact) | Canine Bacteroidales, Assay Name: DogBact | 0 | | | | | | | 2021-12-17 |
Bacteroidales, Human (BacH) | Human Bacteroidales Marker BacH | 0 | | | | | | | 2021-10-18 |
Bacteroidales, Human (HF183/BacR287) | Human Bacteroidales, Assay name: HF183/BacR287, 5'-ATCATGAGTTCACATGTCCG-3', 5'-CTTCCTCTCAGAACCCCTATCC-3' | 0 | Microbiological | | | | | | 2023-01-27 |
Bacteroidales, Human (HF183/BFDrev) | Human Bacteroidales, Assay name: HF183/BFDrev, 5' ATCATGAGTTCACATGTCCG 3', 5' CGTAGGAGTTTGGACCGTGT 3' | 0 | | | | | | | 2022-09-14 |
Bacteroidales, Human (HF183TMCaMan) | Human Bacteroidales, Assay name: HF183TMCaMan, 5? ATCATGAGTTCACATGTCCG 3?, 5? CTTCCTCTCAGAACCCCTATCC 3? | 0 | Microbiological | | | | | | 2022-08-19 |
Bacteroidales, Human (HumM2) | Human Bacteroidales, Assay name: HumM2, 5'-CGTCAGGTTTGTTTCGGTATTG-3', 5'-TCATCACGTAACTTATTTATATGCATTAGC-3' | 0 | Microbiological | | | | | | 2023-01-27 |
Bacteroidales, Porcine (Pig2Bac) | Porcine Bacteroidales, Assay name: Pig2Bac | 0 | Microbiological | | | | | | 2022-02-11 |
Bag, Large/Retail | Bag, Large/Retail | 0 | Debris | Trash | Plastics | Bags/Packaging | | | 2014-11-04 |
Bag, Pet Waste | Bag, Pet Waste | 0 | Debris | Trash | Plastics | Bags/Packaging | | | 2014-11-04 |
Bag, Single Use Plastic | Bag, Single Use Plastic | 0 | Debris | Trash | Plastics | Bags/Packaging | | | 2014-11-04 |
Bag, Takeout | Bag, Takeout | 0 | Debris | Trash | Plastics | Bags/Packaging | | | 2014-11-04 |
Bags/Packaging | Bags/Packaging | 0 | Debris | Trash | Plastics | | | | 2014-11-05 |
Balloon, Latex | Balloon, Latex | 0 | Debris | Trash | Plastics | Miscellaneous | | | 2014-11-04 |
Balloon, Mylar | Balloon, Mylar | 0 | Debris | Trash | Plastics | Miscellaneous | | | 2014-11-04 |
Bandage/Bandaid | Bandage/Bandaid | 0 | Debris | Trash | Plastics | Miscellaneous | | | 2014-11-04 |
Bank Angle | Bank Angle | 0 | Habitat | | | | | | 2009-08-20 |
Bank Cover | Bank Cover | 0 | Habitat | | | | | | 2012-05-22 |
Bank Stability | Bank Stability (score zone 5m up and 5m downstream of transect between bankfull - wetted width) | 0 | Habitat | | | | | | 2009-08-20 |
Bankfull Height | Bankfull Height | 0 | Habitat | | | | | | 2009-08-20 |
Bankfull Width | Bankfull Width | 0 | Habitat | | | | | | 2009-08-20 |
Bankfull Width Reach | Visual estimate of the average bankfull width of the reach | 0 | Habitat | | | | | | 2009-08-20 |
Bar Present | Bar Present | 0 | Habitat | | | | | | 2009-08-20 |
Bar Width | Bar Width | 0 | Habitat | | | | | | 2009-08-20 |
Barban | Barban | 101279 | Organics | Pesticides | Pest-Carbamates | Herbicides | | | 2007-07-27 |
Barban(Surrogate) | Surrogate: Barban | 101279 | Organics | Pesticides | Pest-Carbamates | | | | 2016-03-02 |
Barium | Barium | 7440393 | Inorganics | Metals | | | | | 2007-07-27 |
Barometric Pressure | Barometric Pressure | 0 | Habitat | | | | | | 2011-11-01 |
Batteries, Large | Batteries, Large | 0 | Debris | Trash | Non-Plastics | Toxic | | | 2014-11-04 |
Batteries, Small | Batteries, Small | 0 | Debris | Trash | Non-Plastics | Toxic | | | 2014-11-04 |
Battery Voltage | Battery Voltage | 0 | FieldMeasure | | | | | | 2012-04-23 |
Bearing | Bearing | 0 | Habitat | | | | | | 2009-08-20 |
BeaufortScale | BeaufortScale | 0 | FieldObservations | Habitat | | | | | 2009-08-20 |
Beaver Flow Modifications | Beaver Flow Modifications | 0 | Habitat | | | | | | 2009-08-20 |
Beaver Signs | Beaver Signs | 0 | Habitat | | | | | | 2009-08-20 |
Bendiocarb | Bendiocarb | 22781233 | Organics | Pesticides | Pest-Carbamates | | | | 2013-05-20 |
Bendroflumethiazide | Bendroflumethiazide | 73483 | | | | | | | 2021-05-07 |
Benfluralin | Benfluralin | 1861401 | Organics | Pesticides | Herbicides | | | | 2016-03-10 |
Benomyl | Benomyl | 17804352 | Organics | Pesticides | Pest-Carbamates | Endocrine Disruptors | | | 2007-07-27 |
Benomyl/Carbendazim | Benomyl/Carbendazim | 0 | Organics | Pesticides | | | | | 2016-04-26 |
Bensulfuron Methyl | Bensulfuron Methyl | 83055996 | Organics | Pesticides | Pest-Carbamates | | | | 2013-05-20 |
Bensulide | Bensulide | 741582 | Organics | Herbicides | | | | | 2016-05-20 |
Bentazon | Bentazon | 25057890 | Organics | Pesticides | | | | | 2016-05-20 |
Benz(a)anthracene | Benz(a)anthracene | 56553 | Organics | PAHs | SVOCs | HMW_PAH | | | 2007-07-27 |
Benz(a)anthracene-d12(Surrogate) | Surrogate: Benz(a)anthracene-d12 | 1718532 | Organics | PAHs | SVOCs | HMW_PAH | | | 2016-03-02 |
Benz(a)anthracene-d12/Chrysene-d12(Surrogate) | Surrogate: Benz(a)anthracene-d12/Chrysene-d12 | 0 | Organics | PAHs | | | | | 2014-01-28 |
Benz(a)anthracenes/Chrysenes, C1- | C1-Benz(a)anthracenes/Chrysenes | 0 | Organics | PAHs | | | | | 2014-01-28 |
Benz(a)anthracenes/Chrysenes, C2- | C2-Benz(a)anthracenes/Chrysenes | 0 | Organics | PAHs | | | | | 2014-01-28 |
Benz(a)anthracenes/Chrysenes, C3- | C3-Benz(a)anthracenes/Chrysenes | 0 | Organics | PAHs | | | | | 2014-01-28 |
Benz(a)anthracenes/Chrysenes, C4- | C4-Benz(a)anthracenes/Chrysenes | 0 | Organics | PAHs | | | | | 2014-01-28 |
Benz(e)pyrene-d12(Surrogate) | Surrogate: Benz(e)pyrene-d12 | 205440820 | Organics | PAHs | Semi-VOAs | | | | 2016-03-02 |
Benzaldehyde | Benzaldehyde | 100527 | Organics | VOCs | | | | | 2014-01-29 |
Benzene | Benzene | 71432 | Organics | VOCs | MTBE_BTEX | | | | 2007-07-27 |
Benzidine | Benzidine | 92875 | Organics | SVOCs | | | | | 2014-01-29 |
Benzo [a] Pyrene equivalents | Benzo [a] Pyrene equivalents | 0 | Organics | PAHs | SVOCs | | | | 2007-07-27 |
Benzo(a)fluoranthene | Benzo(a)fluoranthene | 203338 | Organics | PAHs | SVOCs | | | | 2012-05-22 |
Benzo(a)pyrene | Benzo(a)pyrene | 50328 | Organics | PAHs | SVOCs | HMW_PAH | | | 2007-07-27 |
Benzo(a)pyrene-d12(Surrogate) | Surrogate: Benzo(a)pyrene-d12 | 50328 | Organics | PAHs | | | | | 2016-03-02 |
Benzo(b)fluoranthene | Benzo(b)fluoranthene | 205992 | Organics | PAHs | SVOCs | HMW_PAH | | | 2007-07-27 |
Benzo(b)fluoranthene-d12(Surrogate) | Surrogate: Benzo(b)fluoranthene-d12 | 93951985 | Organics | PAHs | | | | | 2016-03-02 |
Benzo(b)fluorene, 11H- | 11H-Benzo(b)fluorene | 243174 | | | | | | | 2019-04-23 |
Benzo(b/j/k)fluoranthene | Benzo(b)fluoranthene/Benzo(j)fluoranthene/Benzo(k)fluoranthene | 0 | Organics | PAHs | Semi-VOAs | HMW_PAH | | | 2013-05-28 |
Benzo(b/j/k)fluoranthene-d12(Surrogate) | Surrogate: Benzo(b)fluoranthene-d12/Benzo(j)fluoranthene-d12/Benzo(k)fluoranthene-d12 | 0 | Organics | PAHs | | | | | 2013-05-28 |
Benzo(b/k)fluoranthene-d12(Surrogate) | Surrogate: Benzo(b)fluoranthene-d12/Benzo(k)fluoranthene-d12 | 0 | Organics | PAHs | | | | | 2013-05-28 |
Benzo(e)pyrene | Benzo(e)pyrene | 192972 | Organics | PAHs | SVOCs | HMW_PAH | | | 2007-07-27 |
Benzo(e)pyrene-d12(Surrogate) | Surrogate: Benzo(e)pyrene-d12 | 205440820 | Organics | PAHs | SVOCs | | | | 2016-03-02 |
Benzo(g,h,i)perylene | Benzo(g,h,i)perylene | 191242 | Organics | PAHs | SVOCs | HMW_PAH | | | 2007-07-27 |
Benzo(g,h,i)perylene-d12(Surrogate) | Surrogate: Benzo(g,h,i)perylene-d12 | 93951667 | Organics | PAHs | SVOCs | HMW_PAH | | | 2016-03-02 |
Benzo(j)fluoranthene | Benzo(j)fluoranthene | 0 | Organics | PAHs | | | | | 2008-11-07 |
Benzo(j/k)fluoranthene | Benzo(j)fluoranthene/Benzo(k)fluoranthene | 0 | Organics | PAHs | SVOCs | HMW_PAH | | | 2013-04-10 |
Benzo(j/k)fluoranthene-d12(Surrogate) | Surrogate: Benzo(j)fluoranthene-d12/Benzo(k)fluoranthene-d12 | 0 | Organics | PAHs | | | | | 2014-01-28 |
Benzo(k)fluoranthene | Benzo(k)fluoranthene | 207089 | Organics | PAHs | SVOCs | HMW_PAH | | | 2007-07-27 |
Benzo(k)fluoranthene-d12(Surrogate) | Surrogate: Benzo(k)fluoranthene-d12 | 0 | Organics | PAHs | | | | | 2014-01-28 |
Benzobicyclon | Benzobicyclon pesticide | 156963665 | | | | | | | 2017-12-12 |
Benzofluoranthenes/Benzopyrenes, C1- | C1-Benzofluoranthenes/Benzopyrenes | 0 | Organics | PAHs | Alkylated PAHs | | | | 2018-07-24 |
Benzofluoranthenes/Benzopyrenes, C2- | C2-Benzofluoranthenes/Benzopyrenes | 0 | Organics | PAHs | Alkylated PAHs | | | | 2018-07-24 |
Benzoic Acid | Benzoic Acid | 0 | Organics | Herbicides | | | | | 2016-05-20 |
Benzophenone | Benzophenone | 119619 | Organics | | | | | | 2018-07-16 |
Benzothiophene | Benzothiophene | 95158 | Organics | PAHs | | | | | 2014-01-28 |
Benzothiophene, C1- | C1-Benzothiophene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Benzothiophene, C2- | C2-Benzothiophene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Benzothiophene, C3- | C3-Benzothiophene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Benzotriazole, 1H | 1H-Benzotriazole | 95147 | | | | | | | 2021-05-07 |
Benzovindiflupyr | Benzovindiflupyr | 1072957711 | Organics | | | | | | 2018-07-16 |
Benzoylecgonine | Benzoylecgonine | 519095 | Organics | PPCPs | | | | | 2010-04-26 |
Benzoylecgonine-d8(Surrogate) | Surrogate: Benzoylecgonine-d8 | 0 | Organics | PPCPs | | | | | 2016-03-02 |
Benztropine | Benztropine | 86135 | Organics | PPCPs | | | | | 2010-04-26 |
Benztropine-d3(Surrogate) | Surrogate: Benztropine-d3 | 0 | Organics | PPCPs | | | | | 2016-03-02 |
Benzyl Alcohol | Benzyl Alcohol | 0 | Organics | VOCs | | | | | 2016-05-20 |
Beryllium | Beryllium | 7440417 | Inorganics | Metals | | | | | 2007-07-27 |
Betamethasone | Betamethasone | 378449 | Organics | PPCPs | | | | | 2010-04-26 |
Bezafibrate | Bezafibrate | 41859670 | | | | | | | 2021-05-07 |
Bicarbonate | Bicarbonate | 71523 | Inorganics | Conventionals | | | Constituents | | 2012-09-13 |
Bicarbonate Alkalinity as CaCO3 | Bicarbonate Alkalinity as CaCO3 | 471341 | Inorganics | Conventionals | WaterQualityMeasurements | | | | 1900-01-01 |
Bifenox | Bifenox | 42576023 | Organics | Pesticides | Herbicides | | | | 2016-10-25 |
Bifenthrin | Bifenthrin | 82657043 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Bifenthrin, Total(Surrogate) | Surrogate: Total Bifenthrin | 0 | | | | | | | 2022-06-07 |
Bifenthrin-d6(Surrogate) | Surrogate: Bifenthrin-d6 | 0 | SVOC | Pesticides | | | | | 2023-08-17 |
Biodegradable | Biodegradeable using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Biodegradable, Other | Biodegradable, Other | 0 | Debris | Natural | Non-Plastics | Biodegradable | | | 2014-11-04 |
Biohazard | Biohazard using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Bioluminescence (EC50) | Bioluminescence (EC50) | 0 | Toxicity | | | | | | 2007-07-27 |
Biomass (wt/orig indiv) | Biomass (weight/original individual) | 0 | Toxicity | | | | | | 2007-07-27 |
BiomassSampleVolume | Volume of material and liquid filtered to produce the biomass (Ash Free Dry Mass-AFDM) sample | 0 | Habitat | | | | | | 2009-10-29 |
Biphenyl | Biphenyl | 92524 | Organics | PAHs | SVOCs | LMW_PAH | | | 2007-07-27 |
Biphenyl-d10(Surrogate) | Surrogate: Biphenyl-d10 | 1486017 | Organics | PAHs | SVOCs | | | | 2007-07-27 |
Biphenyls, C1- | C1-Biphenyls | 0 | Organics | PAHs | LMW_PAH | | | | 2018-07-24 |
Biphenyls, C2- | C2-Biphenyls | 0 | Organics | PAHs | LMW_PAH | | | | 2018-07-24 |
Bis(1,3-dichloro-2-propyl) phosphate | Bis(1,3-dichloro-2-propyl) phosphate (BDCPP) | 72236727 | Organics | FlameRetardants | | | | | 2014-03-13 |
Bis(1H,1H,2H,2H-perfluorodecyl)phosphate | Bis(1H,1H,2H,2H-perfluorodecyl)phosphate (8:2 diPAP) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Bis(1H,1H,2H,2H-perfluorodecyl)phosphate-13C4(Surrogate) | Surrogate: Bis(1H,1H,2H,2H-perfluorodecyl)phosphate-13C4 | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-30 |
Bis(1H,1H,2H,2H-perfluorooctyl)phosphate | Bis(1H,1H,2H,2H-perfluorooctyl)phosphate (6:2 diPAP) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Bis(1H,1H,2H,2H-perfluorooctyl)phosphate-13C4(Surrogate) | Surrogate: Bis(1H,1H,2H,2H-perfluorooctyl)phosphate-13C4 | 0 | Organics | PFAS | PFC Precursor | | | | 2014-11-03 |
Bis(2,4,6-tribromophenoxy)ethane | Bis(2,4,6-tribromophenoxy)ethane | 37853591 | Organics | FlameRetardants | | | | | 2010-01-04 |
Bis(2-chloro-1-methylethyl) ether | Bis(2-chloro-1-methylethyl) ether | 0 | Organics | SVOCs | | | | | 2014-01-29 |
Bis(2-chloroethoxy)methane | Bis(2-chloroethoxy)methane | 111911 | Organics | SVOCs | | | | | 2007-07-27 |
Bis(2-chloroethyl) phosphate | Bis(2-chloroethyl) phosphate (BCEP) | 0 | Organics | FlameRetardants | | | | | 2014-03-13 |
Bis(2-chloroethyl)ether | Bis(2-chloroethyl)ether | 111444 | Organics | SVOCs | | | | | 2007-07-27 |
Bis(2-chloroisopropyl) ether | Bis(2-chloroisopropyl) ether | 39638329 | Organics | SVOCs | | | | | 2016-08-26 |
Bis(2-chloroisopropyl) phosphate | Bis(2-chloroisopropyl) phosphate (BCPP) | 0 | Organics | FlameRetardants | | | | | 2014-03-13 |
Bis(2-ethly-1-hexyl)tetrabromophthalate | Bis(2-ethly-1-hexyl)tetrabromophthalate (BEHTBP) | 26040517 | Organics | FlameRetardants | | | | | 2014-03-13 |
Bis(2-ethylhexyl)adipate | Bis(2-ethylhexyl)adipate | 103231 | Organics | SVOCs | | | | | 2016-05-20 |
Bis(2-ethylhexyl)phthalate | Bis(2-ethylhexyl)phthalate | 117847 | Organics | SVOCs | Endocrine Disruptors | | | | 2007-07-27 |
Bis(2-ethylhexyl)phthalate-d4(Surrogate) | Surrogate: Bis(2-ethylhexyl)phthalate-d4 | 0 | Organics | SVOCs | | | | | 2014-01-29 |
Bis(2-ethylhexyl)tetrabromophthalate | Bis(2-ethylhexyl)tetrabromophthalate | 26040517 | Organics | FlameRetardants | | | | | 2010-01-04 |
Bis(perfluorohexyl)phosphinate | Bis(perfluorohexyl)phosphinate (6:6 PFPi) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Bis(perfluorohexyl)phosphinate-d5(Surrogate) | Surrogate: Bis(perfluorohexyl)phosphinate-d5 | 0 | Organics | PFAS | | | | | 2014-10-02 |
Bis(perfluorooctyl)phosphinate | Bis(perfluorooctyl)phosphinate (8:8 PFPi) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Bis(perfluorooctyl)phosphinate-d3(Surrogate) | Surrogate: Bis(perfluorooctyl)phosphinate-d3 | 0 | Organics | PFAS | | | | | 2014-10-02 |
Bismuth | Bismuth | 7440699 | Inorganics | | | | | | 2013-05-20 |
Bisphenol A | Bisphenol A | 80057 | Organics | PPCPs | | | | | 2010-04-26 |
Bisphenol A bis(diphenyl phosphate) | Bisphenol A bis(diphenyl phosphate) | 5945335 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol A diglycidyl ether | Bisphenol A diglycidyl ether (BPA-DGE) | 16755423 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol A-d14(Surrogate) | Surrogate: Bisphenol A-d14 | 0 | Organics | PPCPs | Bisphenols | | | | 2018-04-18 |
Bisphenol A-d16(IsoDilAnalogue) | Isotope Dilution Analogue: Bisphenol A-d16 | 96210876 | Organics | | | | | | 2022-07-22 |
Bisphenol A-d6(Surrogate) | Surrogate: Bisphenol A-d6 | 0 | Organics | PPCPs | | | | | 2016-03-02 |
Bisphenol AF | Bisphenol AF | 1478611 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol AP | Bisphenol AP | 1571751 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol B | Bisphenol B | 77407 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol BP | Bisphenol BP | 1844015 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol C | Bisphenol C | 79970 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol C-dichloride | Bisphenol C-dichloride | 14868032 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol E | Bisphenol E | 2081085 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol F | Bisphenol F | 620928 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol G | Bisphenol G | 127548 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol M | Bisphenol M | 13595250 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol P | Bisphenol P | 2167513 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol PH | Bisphenol PH | 24038684 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol S | Bisphenol S | 80091 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol TMC | Bisphenol TMC | 129188994 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bisphenol Z | Bisphenol Z | 843550 | Organics | PPCPs | Bisphenols | | | | 2017-09-19 |
Bispyribac Sodium | Bispyribac Sodium | 125401925 | Organics | Pesticides | Herbicides | | | | 2016-10-25 |
Bivalve CI Mean | Bivalve Condition Index Mean | 0 | Organics | Inorganics | Metals | Conventionals | | | 2012-10-30 |
Bivalve CI SE | Bivalve Condition Index Standard Error | 0 | Organics | Inorganics | Metals | Conventionals | | | 2012-10-30 |
Blue-Green Algae Phycocyanin | Blue-Green Algae Phycocyanin (BGA-PC) | 0 | WaterQualityMeasurements | | | | | | 2014-05-07 |
BOD | Biochemical Oxygen Demand (BOD) - 5 day test | 0 | Inorganics | Conventionals | | | | | 2007-07-27 |
BOD10day | Biochemical Oxygen Demand (BOD) - 10 day test | 0 | Inorganics | Conventionals | | | | | 2007-07-27 |
Bolstar | Bolstar (Sulprofos) | 35400432 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Boron | Boron | 7440428 | Inorganics | Conventionals | Metals | Metalloids | | | 2007-07-27 |
Boscalid | Boscalid | 188425856 | Organics | Fungicides | | | | | 2016-05-20 |
Boscalid-5-hydroxy | 5-Hydroxy-Boscalid | 661463872 | Organics | | | | | | 2022-12-22 |
Bottle Cap, Metal | Bottle Cap, Metal | 0 | Debris | Trash | Non-Plastics | Metals | | | 2014-11-04 |
Bottle Cap, Plastic | Bottle Cap, Plastic | 0 | Debris | Trash | Plastics | FoodService | | | 2014-11-04 |
Bottle, Beach | Bottle, Beach | 0 | Debris | Trash | Plastics | Toxic | | | 2014-11-04 |
Bottle, Cleaning | Bottle, Cleaning | 0 | Debris | Trash | Plastics | Toxic | | | 2014-11-04 |
Bottle, Glass | Bottle, Glass | 0 | Debris | Trash | Non-Plastics | Household | | | 2014-11-04 |
Bottle, Plastic | Bottle, Plastic Beverage | 0 | Debris | Trash | Plastics | | | | 2022-11-02 |
Bottle, Shampoo | Bottle, Shampoo | 0 | Debris | Trash | Plastics | Household | | | 2014-11-04 |
Bottle, Soda | Bottle, Soda | 0 | Debris | Trash | Plastics | FoodService | | | 2014-11-04 |
Bottle, Sport | Bottle, Sport | 0 | Debris | Trash | Plastics | FoodService | | | 2014-11-04 |
Bottle, Water | Bottle, Water | 0 | Debris | Trash | Plastics | FoodService | | | 2014-11-04 |
Boulder | Boulder | 0 | Inorganics | Conventionals | GrainSize | | | | 2011-09-08 |
Brick | Brick | 0 | Debris | Trash | Non-Plastics | Construction | | | 2014-11-04 |
Bridge | Bridge | 0 | Habitat | Debris | | | | | 2014-11-04 |
Bridge Fence | Bridge Fence | 0 | Habitat | Debris | | | | | 2014-11-04 |
Bridge Fence Height | Bridge Fence Height | 0 | Habitat | Debris | | | | | 2014-11-04 |
Bridges, Culverts | Bridges, Culverts | 0 | Habitat | | | | | | 2009-08-20 |
Broflanilide | Broflanilide | 1207727045 | Organics | PFAS | | | | | 2022-11-03 |
Bromacil | Bromacil | 314409 | Organics | Pesticides | Pest-Carbamates | Herbicides | | | 2007-07-27 |
Bromate | Bromate | 15541454 | Inorganics | Conventionals | Nutrients | | | | 2013-05-28 |
Bromide | Bromide | 24959679 | Inorganics | Conventionals | Nutrients | | | | 2013-05-28 |
Bromo-2-Nitrobenzene, 1- | 1-Bromo-2-Nitrobenzene | 577195 | Organics | VOCs | | | | | 2019-07-09 |
Bromo-2-Nitrobenzene, 1-(Surrogate) | Surrogate: 1-Bromo-2-Nitrobenzene | 0 | Organics | VOCs | | | | | 2019-07-24 |
Bromo-3,5-dimethylphenyl-N-methylcarbamate, 4-(Surrogate) | Surrogate: 4-Bromo-3,5-dimethylphenyl-N-methylcarbamate (BDMC) | 672991 | Organics | OrganochlorinePesticides | | | | | 2016-03-02 |
Bromobenzene | Bromobenzene (Phenyl Bromide) | 108861 | Organics | VOCs | | | | | 2013-05-28 |
Bromochloromethane | Bromochloromethane | 74975 | Organics | VOCs | | | | | 2007-07-27 |
Bromodichloromethane | Bromodichloromethane (Dichlorobromomethane) | 75274 | Organics | VOCs | | | | | 2011-05-03 |
Bromofluorobenzene, 4- | 4-Bromofluorobenzene | 460004 | Organics | VOCs | | | | | 2016-05-20 |
Bromofluorobenzene, 4-(Surrogate) | Surrogate: 4-Bromofluorobenzene | 460004 | Organics | VOCs | | | | | 2016-03-02 |
Bromoform | Bromoform (Tribromomethane) | 75252 | Organics | VOCs | | | | | 2007-07-27 |
Bromomethane | Bromomethane (Methyl Bromide) | 74839 | Organics | VOCs | | | | | 2013-05-28 |
Bromophenyl Phenyl Ether, 4- | 4-Bromophenyl Phenyl Ether | 101553 | Organics | SVOCs | | | | | 2013-05-28 |
Bromophenyl Phenyl Ether, 4-(Surrogate) | Surrogate: 4-Bromophenyl Phenyl Ether | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Bromuconazole | Bromuconazole (Bromoconazole) | 116255482 | Organics | Pesticides | Fungicides | | | | 2023-02-02 |
Bufencarb | Bufencarb | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
Bulk Density | Bulk Density | 0 | WaterQualityMeasurements | Ancillary | | | | | 2014-02-05 |
Burial | Burial | 0 | Toxicity | | | | | | 2007-07-27 |
Burns Extent | Burns Extent | 0 | Habitat | | | | | | 2019-05-07 |
Burns Intensity | Burns Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Burns Proximity | Burns Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Butachlor | Butachlor | 23184669 | Organics | Herbicides | | | | | 2007-07-27 |
Butalbital | Butalbital | 77269 | | | | | | | 2021-05-07 |
Butanone, 2- | 2-Butanone (Methyl Ethyl Ketone) | 78933 | Organics | VOCs | | | | | 2013-05-28 |
Butralin | Butralin | 33629479 | Organics | Pesticides | Herbicides | | | | 2016-03-10 |
Butyl Benzyl Phthalate | Butyl Benzyl Phthalate | 85687 | Organics | SVOCs | Endocrine Disruptors | | | | 2013-05-28 |
Butyl Benzyl Phthalate-d4(Surrogate) | Surrogate: Butyl Benzyl Phthalate-d4 | 0 | Organics | SVOCs | | | | | 2014-01-29 |
Butylate | Butylate | 2008415 | Organics | Pesticides | Pest-Carbamates | | | | 2007-07-27 |
Butylbenzene, n- | n-Butylbenzene | 104518 | Organics | VOCs | | | | | 2007-07-27 |
Butylbenzene, sec- | sec-Butylbenzene | 135988 | Organics | VOCs | | | | | 2007-07-27 |
Butylbenzene, tert- | tert-Butylbenzene | 98066 | Organics | VOCs | | | | | 2007-07-27 |
Butylhydroxytoluene-d21(Surrogate) | Surrogate: Butylhydroxytoluene-d21 (BHT-d21) | 64502994 | | | | | | | 2022-05-24 |
Butyl-N-ethyl-2,6-dinitro-4-(trifluoromethyl)aniline, N- | N-Butyl-N-ethyl-2,6-dinitro-4-(trifluoromethyl)aniline (Benfluralin) | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Butylparaben | Butylparaben | 94268 | | | | | | | 2021-05-07 |
Butyltin as Sn | Butyltin as Sn | 0 | Organics | Organotins | | | | | 2016-05-20 |
C. coli | | 0 | | | | | | | 2018-02-13 |
C. jejuni | | 0 | | | | | | | 2018-02-13 |
Cadmium | Cadmium | 7440439 | Inorganics | TraceElements | Metals | | | | 2007-07-27 |
Caffeine | Caffeine | 58082 | Organics | PPCPs | | | | | 2009-09-29 |
Caffeine-13C(Surrogate) | Surrogate: Caffeine-13C | 202282982 | Organics | PPCPs | | | | | 2013-05-28 |
Caffeine-13C3(Surrogate) | Surrogate: Caffeine-13C3 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
CAFOs Extent | CAFOs Extent | 0 | Habitat | | | | | | 2019-05-07 |
CAFOs Intensity | CAFOs Intensity | 0 | Habitat | | | | | | 2019-05-07 |
CAFOs Proximity | CAFOs Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Calcium | Calcium | 7440702 | Inorganics | Conventionals | Metals | | Constituents | | 2007-07-27 |
Calcium bis(methylarsonate) | Calcium bis(methylarsonate) | 5902954 | Organics | Pesticides | | | | | 2017-04-20 |
Calcium Bound Phosphorus | Calcium Bound Phosphorus | 0 | Inorganics | Conventional | Nutrients | | | | 2022-03-01 |
Camphor | Camphor | 76222 | Organics | | | | | | 2018-07-16 |
Campylobacter | Campylobacter | 0 | Microbiological | Pathogens | | | | | 2016-05-20 |
Canopy Cover | Canopy Cover | 0 | Habitat | | | | | | 2016-09-06 |
Captafol | Captafol | 2425061 | Organics | Pesticides | Fungicides | | | | 2016-10-25 |
Captan | Captan | 133062 | Organics | Pesticides | Pest-Carbamates | Insecticides | | | 2007-07-27 |
Carbadox | Carbadox | 6804075 | Organics | PPCPs | | | | | 2012-05-22 |
Carbamazepine | Carbamazepine | 298464 | Organics | PPCPs | | | | | 2012-05-22 |
Carbamazepine(Surrogate) | Surrogate: Carbamazepine | 0 | Organics | | | | | | 2017-03-06 |
Carbamazepine-d10(Surrogate) | Surrogate: Carbamazepine-d10 | 0 | Organics | PPCPs | | | | | 2018-01-18 |
Carbaryl | Carbaryl | 63252 | Organics | Pesticides | Pest-Carbamates | Insecticides | | | 2007-07-27 |
Carbazole | Carbazole | 86748 | Organics | SVOCs | | | | | 2007-07-27 |
Carbazole(Surrogate) | Surrogate: Carbazole | 86748 | Organics | Semi-VOAs | | | | | 2011-10-13 |
Carbendazim | Carbendazim | 10605217 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Carbofuran | Carbofuran | 1563662 | Organics | Pesticides | Pest-Carbamates | Insecticides | | | 2007-07-27 |
Carbofuran Phenol | Carbofuran Phenol | 0 | Organics | Pesticides | | | | | 2017-04-04 |
Carbon dioxide, free | Carbon dioxide, free | 124389 | | | | | | | 2017-04-28 |
Carbon Dioxide, total | Carbon Dioxide, total | 124389 | | | | | | | 2017-04-28 |
Carbon Disulfide | Carbon Disulfide | 0 | Inorganics | Conventionals | | | | | 2016-05-20 |
Carbon Tetrachloride | Carbon Tetrachloride | 56235 | Organics | VOCs | | | | | 2013-05-28 |
Carbon, Total | Total Carbon | 7440440 | Inorganics | Conventionals | | | | | 2013-05-20 |
Carbon-13 | Carbon-13 | 14762744 | Organics | Radiochemistry | | | | | 2014-11-05 |
Carbon-13/Carbon-12 Ratio | Carbon-13/Carbon-12 Ratio | 14762744 | Radiochemistry | | | | | | 2013-06-03 |
Carbon-14 | Carbon-14 | 14762755 | Radiochemistry | | | | | | 2013-06-06 |
Carbon-14 Counting Error | Carbon-14 Counting Error | 0 | Inorganics | | | | | | 2013-06-06 |
Carbonate | Carbonate | 3812326 | Inorganics | Conventionals | | | | | 2012-09-13 |
Carbonate Alkalinity as CaCO3 | Carbonate Alkalinity as CaCO3 | 471341 | Inorganics | Conventionals | WaterQualityMeasurements | | | | 1900-01-01 |
Carbophenothion | Carbophenothion (Trithion) | 786196 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Carbophenothion-Methyl | Carbophenothion-Methyl | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
Carboxin | Carboxin (6-methyl-N-phenyl-2,3-dihydro-1,4-oxathiine-5-carboxamide) | 0 | | | | | | | 2017-01-12 |
Carfentrazone Ethyl | Carfentrazone Ethyl | 128639021 | Organics | Pesticides | | | | | 2013-06-27 |
Carisoprodol | Carisoprodol | 78444 | | | | | | | 2021-05-07 |
Cascade/Falls | Cascade/Falls | 0 | Habitat | | | | | | 2009-08-20 |
Catellicoccus, Gull (Gull2) | Gull Catellicoccus marimammalium, Assay name: Gull2, 5'-TGCATCGACCTAAAGTTTTGAG-3', 5'-GTCAAAGAGCGAGCAGTTACTA-3' | 0 | Microbiological | | | | | | 2023-01-27 |
Cattle Grazing Intensity | Cattle Grazing Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Cattle GrazingExtent | Cattle GrazingExtent | 0 | Habitat | | | | | | 2019-05-07 |
Cattle GrazingProximity | Cattle GrazingProximity | 0 | Habitat | | | | | | 2019-05-07 |
CBOD5 | Carbonaceous Biological Oxygen Demand (CBOD) - 5 day test | 0 | WaterQualityMeasurements | Conventionals | | | | | 2018-01-18 |
CD/DVD | CD/DVD | 0 | Debris | Trash | Plastics | Household | | | 2014-11-04 |
CDOM | Colored Dissolved Organic Matter | 0 | Habitat | | | | | | 2013-12-18 |
Cefotaxime | Cefotaxime | 63527526 | Organics | PPCPs | | | | | 2010-04-26 |
Celestolide | Celestolide | 0 | Organics | Pesticides | | | | | 2008-06-27 |
Cellulose Acetate Fiber | Cellulose acetate Fiber | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Cellulose Acetate Fiber Bundle | Cellulose acetate Fiber Bundle | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Cellulose Acetate Film | Cellulose acetate Film | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Cellulose Acetate Fragment | Cellulose acetate Fragment | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Cellulose Acetate Sphere | Cellulose acetate Sphere | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Cellulosic Fiber | Cellulosic Fiber | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Cellulosic Fiber Bundle | Cellulosic Fiber Bundle | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Cellulosic Film | Cellulosic Film | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Cellulosic Foam | Cellulosic Foam | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Cellulosic Fragment | Cellulosic Fragment | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Ceramic Pot/Shard | Ceramic Pot/Shard | 0 | Debris | Trash | Non-Plastics | Household | | | 2014-11-04 |
Cerium | Cerium | 7440451 | Inorganics | | | | | | 2013-05-20 |
Cesium | Cesium | 7440462 | Inorganics | Metals | | | | | 2009-08-05 |
Chamber biomass | Chamber biomass | 0 | Toxicity | | | | | | 2007-07-27 |
Channel Constraining Feature | Channel Constraining Feature | 0 | Habitat | | | | | | 2009-08-20 |
Channel Constraint | Channel Constraint | 0 | Habitat | | | | | | 2009-08-20 |
Channel Engineered | Channel has been modified/engineered | 0 | Habitat | FieldObservations | | | | | 2016-03-02 |
Channel Grasses | Channel Grasses | 0 | Habitat | | | | | | 2019-05-07 |
Channel Margin in Contact | Channel Margin in Contact | 0 | Habitat | | | | | | 2009-08-20 |
Channel NonWoody Veg | Channel NonWoody Veg | 0 | Habitat | | | | | | 2019-05-07 |
Channel Pattern | Channel Pattern | 0 | Habitat | | | | | | 2009-08-20 |
Channel Unit | Channel Unit | 0 | Habitat | | | | | | 2009-08-20 |
Channel Width Reach | Channel width used to define reach | 0 | Habitat | | | | | | 2009-10-29 |
Channel Woody Veg | Channel Woody Veg | 0 | Habitat | | | | | | 2019-05-07 |
Channelization | Channelization | 0 | Habitat | | | | | | 2009-08-20 |
Chemical Concentration | Chemical Concentration | 0 | Toxicity | | | | | | 2013-05-28 |
Chemical Group A | Total of (Aldrin,Dieldrin,Endrin,Heptachlor,Heptachlor Epoxide,Chlorine,HCH, Endosulfan,Toxaphene) | 0 | Organics | Pesticides | | | | | 2014-01-28 |
Chemical Group B | Total of (1,2-Dichloropropane, 1,3-Dichloropropene and related C3 Compounds) | 0 | Organics | Pesticides | | | | | 2017-04-20 |
Chemical Treatment | Chemical Treatment | 0 | Habitat | | | | | | 2009-08-20 |
Chloramben | Chloramben | 133904 | Organics | Herbicides | | | | | 2016-05-20 |
Chloramben, ammonium salt | Chloramben, ammonium salt | 1076466 | Organics | Pesticides | | | | | 2017-04-10 |
Chloramphenicol | Chloramphenicol | 56757 | | | | | | | 2021-05-07 |
Chlorantraniliprole | Chlorantraniliprole | 500008457 | Organics | Pesticides | Insecticides | | | | 2016-03-10 |
Chlorate | Chlorate | 14866683 | Inorganics | Conventionals | Nutrients | | | | 2013-05-28 |
Chlorbenside | Chlorbenside | 0 | Organics | Pesticides | | | | | 2008-11-07 |
Chlordane | Chlordane, not otherwise specified | 57749 | Organics | Pesticides | Pest-OCHs | | | | 2007-12-14 |
Chlordane, cis- | cis-Chlordane (alpha-Chlordane) | 5103719 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2013-05-28 |
Chlordane, cis-(Surrogate) | Surrogate: cis-Chlordane (alpha-Chlordane) | 5103719 | Organics | Pesticides | | | | | 2013-05-27 |
Chlordane, Technical | Chlordane, mixture of many related chemicals, of which 10 are major components | 12789036 | Organics | Pesticides | Pest-OCHs | | | | 2007-07-27 |
Chlordane, Total | Total Chlordane, sum of cis-chlordane and trans-chlordane | 0 | | | | | | | 2019-06-11 |
Chlordane, trans- | trans-Chlordane (gamma-Chlordane) | 5103742 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2013-05-28 |
Chlordane, trans-(Surrogate) | Surrogate: trans-Chlordane (gamma-Chlordane) | 0 | Organics | Pesticides | | | | | 2013-05-27 |
Chlordane, trans-13C10(IsoDilAnalogue) | Isotopic Dilution Analogue: trans-Chlordane-13C10 (gamma-Chlordane) | 0 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
Chlordene | Chlordene | 3734483 | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | | 2007-07-27 |
Chlordene Plus | Chlordene Plus (CP) | 0 | Organics | FlameRetardants | | | | | 2014-03-13 |
Chlordene, cis- | cis-Chlordene (alpha-Chlordene) | 56534022 | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | | 2013-05-28 |
Chlordene, trans- | trans-Chlordene (gamma-Chlordene) | 56641384 | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | | 2013-05-28 |
Chlorfenac | Chlorfenac (Fenac) | 85347 | Organics | Pesticides | Herbicides | | | | 2017-04-20 |
Chlorfenapyr | Chlorfenapyr | 122453730 | Organics | Pesticides | | | | | 2016-10-25 |
Chlorfenvinphos | Chlorfenvinphos | 470906 | Organics | Pesticides | Pest-OPs | | | | 2007-07-27 |
Chloride | Chloride | 16887006 | Inorganics | Conventionals | Nutrients | | Constituents | | 2007-07-27 |
Chlorimuron Ethyl | Chlorimuron Ethyl | 90982324 | Organics | SVOCs | | | | | 2013-05-20 |
Chlorine, Free | Free Chlorine | 0 | WaterQualityMeasurements | Ancillary | | | | | 2014-02-05 |
Chlorine, Total Residual | Total Residual Chlorine | 0 | WaterQualityMeasurements | | | | | | 2007-07-27 |
Chlorite | Chlorite | 14998277 | Inorganics | Conventionals | Nutrients | | | | 2013-05-28 |
Chlormefos | Chlormefos | 0 | | | | | | | 2019-12-28 |
Chloro-2-methylphenol, 4- | 4-Chloro-2-methylphenol | 1570645 | Organics | Pesticides | | | | | 2017-04-20 |
Chloro-2-methylphenoxy) Butanoic Acid Sodium Salt, 4-(4- | 4-(4-Chloro-2-methylphenoxy) Butanoic Acid sodium salt (MCPB, sodium salt) | 6062266 | Organics | Pesticides | | | | | 2017-04-10 |
Chloro-2-methylphenoxy) Butanoic Acid, 4-(4- | 4-(4-Chloro-2-methylphenoxy) Butanoic Acid (MCPB) | 94815 | Organics | SVOCs | | | | | 2013-05-20 |
Chloro-3-methylphenol, 4- | 4-Chloro-3-methylphenol | 59507 | Organics | SVOCs | Phenols | Chlorinated Phenols | | | 2007-07-27 |
Chloro-3-methylphenol, 4-(Surrogate) | Surrogate: 4-Chloro-3-methylphenol | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Chloro-4-isopropylamine-6-amino-s-triazine, 2- | 2-Chloro-4-isopropylamine-6-amino-s-triazine (CIAT) | 0 | Organics | Pesticides | | | | | 2017-04-04 |
Chloroallyl alcohol, total | Total Chloroallyl alcohol | 0 | Organics | Pesticides | | | | | 2017-04-10 |
Chloroaniline, 4- | 4-Chloroaniline | 106478 | Organics | SVOCs | | | | | 2007-07-27 |
Chlorobenzene | Chlorobenzene | 108907 | Organics | VOCs | | | | | 2007-07-27 |
Chlorobenzene-d5(Surrogate) | Surrogate: Chlorobenzene-d5 | 3114554 | Organics | VOCs | | | | | 2016-03-02 |
Chlorobenzilate | Chlorobenzilate | 510156 | Organics | Pesticides | | | | | 2016-10-25 |
Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid, 11- | 11-Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid | 763051929 | Organics | PFAS | | | | | 2019-08-28 |
Chloroethane | Chlorethane (Ethyl Chloride) | 75003 | Organics | VOCs | | | | | 2013-05-28 |
Chloroethyl Vinyl Ether, 2 | 2-Chloroethyl Vinyl Ether | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Chloroethyl Vinyl Ether, 2- | 2-Chloroethyl Vinyl Ether | 110758 | Organics | VOCs | | | | | 2013-05-28 |
Chloroethyl Vinyl Ether, 2-(Surrogate) | Surrogate: 2-Chloroethyl Vinyl Ether | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Chloroform | Chloroform | 67663 | Organics | VOCs | Insecticides | | | | 2007-07-27 |
Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid, 9- | 9-Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid | 756426581 | Organics | PFAS | | | | | 2019-08-28 |
Chloromethane | Chloromethane (Methyl Chloride) | 74873 | Organics | VOCs | | | | | 2013-05-28 |
Chloro-N-(2,6-diethylphenyl) acetamide, 2- | 2-chloro-N-(2,6-diethylphenyl) acetamide | 6967299 | Organics | Pesticides | | | | | 2017-04-10 |
Chloro-N-(ethoxymethyl)-N-(2-ethyl-6-methylphenyl)acetamide, 2- | 2-Chloro-N-(ethoxymethyl)-N-(2-ethyl-6-methylphenyl)acetamide (Acetochlor) | 34256821 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Chloronaphthalene, 2- | 2-Chloronaphthalene | 91587 | Organics | SVOCs | | | | | 2007-07-27 |
Chloronaphthalene, 2-(Surrogate) | Surrogate: 2-Chloronaphthalene | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Chloroneb | Chloroneb | 0 | Organics | Pesticides | Fungicides | | | | 2017-04-04 |
Chloroneb(Surrogate) | Surrogate: Chloroneb | 2675776 | Organics | Pesticides | Pest-OCHs | Fungicides | | | 2010-05-02 |
Chloronicotinic acid, 6- | 6-Chloronicotinic acid | 5326238 | Organics | Pesticides | Insecticides | Neonics | | | 2017-10-05 |
Chlorophenol, 2- | 2-Chlorophenol | 95578 | Organics | SVOCs | Phenols | Chlorinated Phenols | | | 2007-07-27 |
Chlorophenol, 2-(Surrogate) | Surrogate: 2-Chlorophenol | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Chlorophenol-d4, 2- (Surrogate) | 2-Chlorophenol-d4 (Surrogate) | 93951736 | | | | | | | 2017-01-12 |
Chlorophenyl Phenyl Ether, 4- | 4-Chlorophenyl Phenyl Ether | 7005723 | Organics | SVOCs | | | | | 2013-05-28 |
Chlorophenyl Phenyl Ether, 4-(Surrogate) | Surrogate: 4-Chlorophenyl Phenyl Ether | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Chlorophenyl)-N'-methylurea, N-(4- | N-(4-Chlorophenyl)-N'-methylurea | 5352885 | Organics | Herbicides | | | | | 2013-05-20 |
Chlorophyll a | Chlorophyll a | 479618 | Inorganics | Conventionals | Benthic | WaterQualityMeasurements | | | 2011-11-10 |
Chlorophyll a & b | Chlorophyll a & b | 0 | Inorganics | Conventionals | | | | | 2016-05-20 |
Chlorophyll b | Chlorophyll b | 0 | Inorganics | Conventionals | | | | | 2016-05-20 |
Chlorophyll c | Chlorophyll c | 0 | WaterQualityMeasurements | | | | | | 2018-01-16 |
Chlorophyll, Total | Total Chlorophyll | 0 | WaterQualityMeasurements | | | | | | 2011-05-03 |
ChlorophyllSampleVolume | Volume of material and liquid filtered to produce the chlorophyll a sample | 0 | Habitat | | | | | | 2009-10-29 |
Chloropicrin | Chloropicrin | 0 | Organics | Pesticides | | | | | 2017-04-04 |
Chloropropylate | Chloropropylate | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
Chloro-p-toluidine hydrochloride, 3- | 3-chloro-p-toluidine hydrochloride | 7745893 | Organics | Pesticides | | | | | 2017-04-10 |
Chlorothalonil | Chlorothalonil | 1897456 | Organics | Pesticides | Pest-OCHs | Algaecides | | | 2007-07-27 |
Chlorotoluene, 2- | 2-Chlorotoluene | 95498 | Organics | VOCs | | | | | 2007-07-27 |
Chlorotoluene, 4- | 4-Chlorotoluene | 106434 | Organics | VOCs | | | | | 2007-07-27 |
Chlorotoluron | Chlorotoluron | 15545489 | | | | | | | 2021-05-07 |
Chloroxuron | Chloroxuron (Chloroxyfenidim) (Norex) | 1982474 | Organics | Herbicides | | | | | 2013-05-28 |
Chloroxuron(Surrogate) | Surrogate: Chloroxuron (Chloroxyfenidim) (Norex) | 0 | Organics | Pesticides | Herbicides | | | | 2017-02-27 |
Chlorpropham | Chlorpropham | 101213 | Organics | Pesticides | Pest-Carbamates | Herbicides | | | 2007-07-27 |
Chlorpyrifos | Chlorpyrifos | 2921882 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Chlorpyrifos Methyl | Chlorpyrifos Methyl | 5598130 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2013-05-28 |
Chlorpyrifos Methyl(Surrogate) | Surrogate: Chlorpyrifos Methyl | 5598130 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2016-03-02 |
Chlorpyrifos Methyl/Fenchlorphos | Chlorpyrifos Methyl/Fenchlorphos | 0 | Organics | Pesticides | | | | | 2016-05-20 |
Chlorpyrifos Oxon | Chlorpyrifos Oxon | 5598152 | Organics | Pesticides | OrganophosphatePest. | Insecticides | | | 2013-05-29 |
Chlorpyrifos(Surrogate) | Surrogate: Chlorpyrifos | 2921882 | Organics | Pesticides | OrganophosphatePest. | Insecticides | | | 2013-06-17 |
Chlorsulfuron | Chlorsulfuron | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Chlortetracycline | Chlortetracycline | 57625 | Organics | PPCPs | | | | | 2012-05-22 |
Chlorthal-Dimethyl, Total | Total Chlorthal-Dimethyl | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Chlorzoxazone | Chlorzoxazone | 95250 | | | | | | | 2021-03-15 |
Cholesterol | Cholesterol | 57885 | Organics | | | | | | 2018-07-16 |
Chromium | Chromium | 7440473 | Inorganics | TraceElements | Metals | | | | 2007-07-27 |
Chromium III | Chromium III (Trivalent Chromium) | 18540300 | Metals | | | | | | 2014-01-24 |
Chromium VI | Chromium VI | 18540299 | Metals | | | | | | 2011-10-25 |
Chrysene | Chrysene | 218019 | Organics | PAHs | SVOCs | HMW_PAH | | | 2007-07-27 |
Chrysene/Triphenylene | Chrysene/Triphenylene (CAS #EDF-359) | 0 | Organics | PAHs | | | | | 2012-05-22 |
Chrysene-d12(Surrogate) | Surrogate: Chrysene-d12 | 1719035 | Organics | PAHs | SVOCs | HMW_PAH | | | 2007-07-27 |
Chrysenes, C1- | C1-Chrysenes | 0 | Organics | PAHs | SVOCs | HMW_PAH | | | 2010-06-21 |
Chrysenes, C2- | C2-Chrysenes | 0 | Organics | PAHs | SVOCs | HMW_PAH | | | 2010-06-21 |
Chrysenes, C3- | C3-Chrysenes | 0 | Organics | PAHs | SVOCs | HMW_PAH | | | 2010-06-21 |
Chrysenes, C4- | C4-Chrysenes | 0 | Organics | PAHs | | | | | 2012-04-04 |
Cigarette Box/Wrapper | Cigarette Box/Wrapper | 0 | Debris | Trash | Plastics | Miscellaneous | | | 2014-11-04 |
Cigarette Butt | Cigarette Butt | 0 | Debris | Trash | Plastics | Toxic | | | 2014-11-04 |
Cimetidine | Cimetidine | 51481619 | Organics | PPCPs | | | | | 2010-04-26 |
Cimetidine-d3(Surrogate) | Surrogate: Cimetidine-d3 | 0 | Organics | PPCPs | | | | | 2016-03-02 |
Cinerin-1 | Cinerin-1 | 25402066 | Organics | Pesticides | Pyrethroids | | | | 2011-05-14 |
Cinerin-2 | Cinerin-2 (Cinerin II) | 121200 | Organics | Pesticides | Pyrethroids | | | | 2013-05-27 |
Ciodrin | Ciodrin (Crotoxyphos) | 7700176 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Ciprofloxacin | Ciprofloxacin | 85721331 | Organics | PPCPs | | | | | 2010-04-26 |
Ciprofloxacin-13C3-N15(Surrogate) | Surrogate: Ciprofloxacin-13C3-N15 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Circumference | Circumference | 0 | Habitat | | | | | | 2012-09-13 |
Clarithromycin | Clarithromycin | 81103119 | Organics | PPCPs | | | | | 2010-04-26 |
Clay | Clay | 0 | Inorganics | Conventionals | GrainSize | | | | 2011-09-08 |
Clinafloxacin | Clinafloxacin | 105956998 | Organics | PPCPs | | | | | 2010-04-26 |
Clofibric acid | Clofibric acid | 882097 | | | | | | | 2021-05-07 |
Clomazone | Clomazone (Dimethazone) | 81777891 | Organics | Pesticides | Herbicides | | | | 2013-05-30 |
Clonidine | Clonidine | 4205907 | Organics | PPCPs | | | | | 2010-04-26 |
Clonidine-d4(Surrogate) | Surrogate: Clonidine-d4 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Clostridiales, Human (LACHNO3) | Human Clostridiales, Assay Name: LACHNO3 | 0 | | | | | | | 2021-12-14 |
Clothianidin | Clothianidin | 210880925 | Pesticides | | | | | | 2012-06-21 |
Clothianidin-d3(Surrogate) | Surrogate: Clothianidin-d3 | 0 | Organics | Pesticides | | | | | 2018-08-07 |
Clothianidin-Desmethyl | Clothianidin-Desmethyl | 135018154 | Organics | | | | | | 2022-10-28 |
Clothing, synthetic fabric | Clothing, synthetic fabric | 0 | Debris | Trash | Plastics | Household | | | 2014-11-04 |
CloudCover | Cloud cover at the time of sampling | 0 | Habitat | | | | | | 2012-09-13 |
Cloxacillin | Cloxacillin | 61723 | Organics | PPCPs | | | | | 2010-04-26 |
Cobalt | Cobalt | 7440484 | Inorganics | Metals | | | | | 2007-07-27 |
Cobble | Cobble | 0 | Inorganics | Conventionals | GrainSize | | | | 2011-09-08 |
Cocaine | Cocaine | 50362 | Organics | PPCPs | | | | | 2010-04-26 |
Cocaine-d3(Surrogate) | Surrogate: Cocaine-d3 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Cocoons | Cocoons (#) | 0 | Toxicity | | | | | | 2007-07-27 |
COD | Chemical Oxygen Demand (COD) | 0 | Inorganics | Conventionals | | | | | 2007-07-27 |
Codeine | Codeine | 76573 | Organics | PPCPs | | | | | 2010-04-26 |
Codeine-d6(Surrogate) | Surrogate: Codeine-d6 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Coliform Ratio | The ratio of fecal/total coliform bacteria exceeds 0.1 and the total coliform bacteria exceeds 1000 | 0 | Microbiological | NULL | | | | | 2016-05-20 |
Coliform, Fecal | Fecal Coliform | 0 | Microbiological | Pathogens | Conventionals | | | | 2010-09-29 |
Coliform, Total | Total Coliform | 0 | Microbiological | Pathogens | Conventionals | | | | 2010-09-29 |
CollectionDepth | Depth at which sample was collected | 0 | WaterQualityMeasurements | | | | | | 2013-05-28 |
Colloid | Colloid | 0 | | | | | | | 2020-03-13 |
CollSub_PlantDead | Algae collected from dead plant (including wood) substratum | 0 | Habitat | | | | | | 2012-09-13 |
CollSub_PlantLive | Algae collected from live plant (including wood) substratum | 0 | Habitat | | | | | | 2012-09-13 |
CollSub_Rock | Algae collected from rock (including concrete and consolidated sediment) substratum | 0 | Habitat | | | | | | 2012-09-13 |
CollSub_SedSoft | Algae collected from soft sediment substratum | 0 | Habitat | | | | | | 2012-09-13 |
Color | Color | 0 | FieldObservations | Habitat | | | | | 2009-08-20 |
Color, True | Color of water from which turbidity has been removed | 0 | Inorganics | Conventionals | | | | | 2012-09-13 |
Commercial | Commercial | 0 | Habitat | | | | | | 2009-08-20 |
CompositeVolume | Volume of material and liquid in Composite sample | 0 | Habitat | | | | | | 2009-10-29 |
Composition | Composition | 0 | FieldObservations | Habitat | | | | | 2009-08-20 |
Computer | Computer | 0 | Debris | Trash | Plastics | Non-Plastics | | | 2014-11-04 |
Concrete/Asphalt | Concrete/Asphalt | 0 | Debris | Trash | Non-Plastics | Construction | | | 2014-11-04 |
Condom | Condom | 0 | Debris | Trash | Plastics | | | | 2022-11-02 |
Construction | Construction | 0 | Habitat | | | | | | 2008-04-02 |
Construction Debris | Construction debris such as brick, wood, sheetrock using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Construction Other | Construction Other | 0 | Debris | Trash | Non-Plastics | Construction | | | 2014-11-04 |
Construction Wood/Pellets | Construction Wood/Pellets | 0 | Debris | Trash | Non-Plastics | Large | | | 2014-11-04 |
Container, Chemical | Container, Chemical | 0 | Debris | Trash | Plastics | Toxic | | | 2014-11-04 |
Container, Juice | Container, Juice | 0 | Debris | Trash | Plastics | FoodService | | | 2014-11-04 |
Container, Plastic | Container, Plastic | 0 | Debris | Trash | Plastics | | | | 2022-11-02 |
Container, Storage | Container, Storage | 0 | Debris | Trash | Plastics | Household | | | 2014-11-04 |
Container, Styrofoam | Container, Styrofoam | 0 | Debris | Trash | Plastics | FoodService | | | 2014-11-04 |
Copper | Copper | 7440508 | Inorganics | TraceElements | Metals | | | | 2007-07-27 |
Coprostanol, beta-3- | 3-beta-Coprostanol | 360689 | Organics | | | | | | 2018-07-18 |
Coronene | Coronene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Cotinine | Cotinine | 486566 | Organics | PPCPs | | | | | 2010-04-26 |
Cotinine-d3(Surrogate) | Surrogate: Cotinine-d3 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Cotton fiber | When cotton is obviously the top hit and cellulose is several hits down. Then we can say it is specifically Cotton. For DYED or CLEAR anthropogenic cotton only and should just be called cotton. | 0 | Microdebris | Anthropogenic | Natural Based | Fiber | | | 2018-04-26 |
Cotton Fiber Bundle | Cotton Fiber Bundle | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Cotton Film | Cotton Film | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Cotton Foam | Cotton Foam | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Cotton Fragment | Cotton Fragment | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Coumaphos | Coumaphos | 56724 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
CPOM | Coarse particulate organic matter | 0 | Habitat | | | | | | 2009-08-20 |
Cresyl Diphenyl Phosphate | Cresyl Diphenyl Phosphate | 26444495 | Organics | FlameRetardants | PhosphateFlameRetardants | | | | 2017-09-19 |
Cropland | Cropland | 0 | Habitat | | | | | | 2009-08-20 |
Crops Irrigated Extent | Crops Irrigated Extent | 0 | Habitat | | | | | | 2019-05-07 |
Crops Irrigated Intensity | Crops Irrigated Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Crops Irrigated Proximity | Crops Irrigated Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Crops NonIrrigated Extent | Crops NonIrrigated Extent | 0 | Habitat | | | | | | 2019-05-07 |
Crops NonIrrigated Intensity | Crops NonIrrigated Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Crops NonIrrigated Proximity | Crops NonIrrigated Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Crutomate | Crutomate | 0 | Organics | Pesticides | | | | | 2017-04-04 |
Cryptosporidium | Cryptosporidium | 0 | Microbiological | Pathogens | Conventionals | | | | 2013-05-28 |
Cryptosporidium Oocysts Fluorescence | Cryptosporidium Oocysts Fluorescence | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Cryptosporidium Oocysts/Amorphous Structure | Cryptosporidium Oocysts/Amorphous Structure | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Cryptosporidium Oocysts/DAPI & DIC Positive | Cryptosporidium Oocysts/DAPI & DIC Positive | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Cryptosporidium Oocysts/Empty | Cryptosporidium Oocysts/Empty | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Cryptosporidium Oocysts/Flourescence Antibody | Cryptosporidium Oocysts/Flourescence Antibody | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Cryptosporidium Oocysts/Internal Structure | Cryptosporidium Oocysts/Internal Structure | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Cryptosporidium Oocysts/Internal Structure (One) | Cryptosporidium Oocysts/Internal Structure (One) | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Cryptosporidium Oocysts/Negative | Cryptosporidium Oocysts/Negative | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Cryptosporidium Oocysts/Positive | Cryptosporidium Oocysts/Positive | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Cryptosporidium Oocysts/Positive (Internal Staining) | Cryptosporidium Oocysts/Positive (Internal Staining) | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Cryptosporidium Oocysts/Positive (Stained Nuclei) | Cryptosporidium Oocysts/Positive (Stained Nuclei) | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Cryptosporidium Oocysts/Total IFA Count | Cryptosporidium Oocysts/Total IFA Count | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
CSCI | California Stream Condition Index score, calculated as the average of the O/E and pMMI | 0 | Habitat | | | | | | 2016-06-21 |
CSCI_CaptureProb_Abedus | Probability of capturing Abedus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Acari | Probability of capturing Acari calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Acentrella | Probability of capturing Acentrella calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Acneus | Probability of capturing Acneus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Aeshna_Rhionaeshna | Probability of capturing Aeshna or Rhionaeshna calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Agabinus | Probability of capturing Agabinus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Agabus | Probability of capturing Agabus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Agapetus | Probability of capturing Agapetus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Allocosmoecus | Probability of capturing Allocosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ambrysus | Probability of capturing Ambrysus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ameletus | Probability of capturing Ameletus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ametor | Probability of capturing Ametor calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Amiocentrus | Probability of capturing Amiocentrus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Amphicosmoecus | Probability of capturing Amphicosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ampumixis | Probability of capturing Ampumixis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Anacaena | Probability of capturing Anacaena calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Anagapetus | Probability of capturing Anagapetus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Anax | Probability of capturing Anax calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Anchycteis | Probability of capturing Anchycteis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Antocha | Probability of capturing Antocha calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Apatania | Probability of capturing Apatania calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Archilestes | Probability of capturing Archilestes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Arctopsyche | Probability of capturing Arctopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Argia | Probability of capturing Argia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Asellidae | Probability of capturing Asellidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Asioplax | Probability of capturing Asioplax calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Astacidae | Probability of capturing Astacidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Atherix | Probability of capturing Atherix calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Atractelmis | Probability of capturing Atractelmis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Atrichopogon | Probability of capturing Atrichopogon calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Attenella | Probability of capturing Attenella calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Baetis | Probability of capturing Baetis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Berosus | Probability of capturing Berosus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Bezzia_Palpomyia | Probability of capturing Bezzia or Palpomyia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Blephariceridae | Probability of capturing Blephariceridae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Brachycentrus | Probability of capturing Brachycentrus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Brechmorhoga | Probability of capturing Brechmorhoga calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Caenis | Probability of capturing Caenis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Calineuria | Probability of capturing Calineuria calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Callibaetis | Probability of capturing Callibaetis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Callicorixa | Probability of capturing Callicorixa calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Calliperla | Probability of capturing Calliperla calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Caloparyphus_Euparyphus | Probability of capturing Caloparyphus or Euparyphus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Calopterygidae | Probability of capturing Calopterygidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Camelobaetidius | Probability of capturing Camelobaetidius calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Capniidae | Probability of capturing Capniidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Caudatella | Probability of capturing Caudatella calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Centroptilum | Probability of capturing Centroptilum calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ceraclea | Probability of capturing Ceraclea calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ceratopogon | Probability of capturing Ceratopogon calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ceratopsyche_Hydropsyche | Probability of capturing Ceratopsyche or Hydropsyche calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Chelifera_Metachela | Probability of capturing Chelifera or Metachela calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Cheumatopsyche | Probability of capturing Cheumatopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Chimarra | Probability of capturing Chimarra calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Chironominae | Probability of capturing Chironominae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Choroterpes | Probability of capturing Choroterpes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Chrysops | Probability of capturing Chrysops calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Chyranda | Probability of capturing Chyranda calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Cinygma | Probability of capturing Cinygma calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Cinygmula | Probability of capturing Cinygmula calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Claassenia | Probability of capturing Claassenia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Cleptelmis | Probability of capturing Cleptelmis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Clinocera | Probability of capturing Clinocera calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Cloeodes | Probability of capturing Cloeodes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Clostoeca | Probability of capturing Clostoeca calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Cordulegaster | Probability of capturing Cordulegaster calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Corduliidae | Probability of capturing Corduliidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Corydalus | Probability of capturing Corydalus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Crangonyx | Probability of capturing Crangonyx calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Cryptochia | Probability of capturing Cryptochia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Cryptolabis | Probability of capturing Cryptolabis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Culicidae | Probability of capturing Culicidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Culicoides | Probability of capturing Culicoides calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Cultus | Probability of capturing Cultus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Cymbiodyta | Probability of capturing Cymbiodyta calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Dasyhelea | Probability of capturing Dasyhelea calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Desmona | Probability of capturing Desmona calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Despaxia | Probability of capturing Despaxia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Deuterophlebia | Probability of capturing Deuterophlebia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Diamesinae | Probability of capturing Diamesinae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Dicosmoecus | Probability of capturing Dicosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Dicranota | Probability of capturing Dicranota calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Diphetor | Probability of capturing Diphetor calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Diplectrona | Probability of capturing Diplectrona calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Diura | Probability of capturing Diura calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Dixa | Probability of capturing Dixa calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Dixella | Probability of capturing Dixella calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Dolichopodidae | Probability of capturing Dolichopodidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Dolophilodes | Probability of capturing Dolophilodes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Doroneuria | Probability of capturing Doroneuria calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Drunella | Probability of capturing Drunella calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Dubiraphia | Probability of capturing Dubiraphia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Dysmicohermes | Probability of capturing Dysmicohermes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ecclisomyia | Probability of capturing Ecclisomyia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ecdyonurus | Probability of capturing Ecdyonurus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Enallagma | Probability of capturing Enallagma calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Enochrus | Probability of capturing Enochrus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Epeorus | Probability of capturing Epeorus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ephemerella | Probability of capturing Ephemerella calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ephydridae | Probability of capturing Ephydridae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Eubrianax | Probability of capturing Eubrianax calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Eurylophella | Probability of capturing Eurylophella calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Fallceon | Probability of capturing Fallceon calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Farula | Probability of capturing Farula calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ferrissia | Probability of capturing Ferrissia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Forcipomyia | Probability of capturing Forcipomyia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Fossaria | Probability of capturing Fossaria calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Frisonia | Probability of capturing Frisonia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Gammarus | Probability of capturing Gammarus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Glossiphoniidae | Probability of capturing Glossiphoniidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Glossosoma | Probability of capturing Glossosoma calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Glutops | Probability of capturing Glutops calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Goera | Probability of capturing Goera calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Gomphus | Probability of capturing Gomphus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Gonomyia | Probability of capturing Gonomyia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Graptocorixa | Probability of capturing Graptocorixa calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Gumaga | Probability of capturing Gumaga calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Gyraulus | Probability of capturing Gyraulus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Gyrinus | Probability of capturing Gyrinus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Haliplus | Probability of capturing Haliplus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Haploperla | Probability of capturing Haploperla calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hedriodiscus_Odontomyia | Probability of capturing Hedriodiscus or Odontomyia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Helichus | Probability of capturing Helichus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Helicopsyche | Probability of capturing Helicopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Helisoma | Probability of capturing Helisoma calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Helodon_Prosimulium | Probability of capturing Helodon or Prosimulium calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Helophorus | Probability of capturing Helophorus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hemerodromia | Probability of capturing Hemerodromia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Heptagenia | Probability of capturing Heptagenia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hesperoconopa | Probability of capturing Hesperoconopa calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hesperoperla | Probability of capturing Hesperoperla calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hesperophylax | Probability of capturing Hesperophylax calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Heterelmis | Probability of capturing Heterelmis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Heterlimnius | Probability of capturing Heterlimnius calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Heteroplectron | Probability of capturing Heteroplectron calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hexatoma | Probability of capturing Hexatoma calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Himalopsyche | Probability of capturing Himalopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Homoleptohyphes | Probability of capturing Homoleptohyphes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hyalella | Probability of capturing Hyalella calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hydatophylax | Probability of capturing Hydatophylax calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hydra | Probability of capturing Hydra calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hydraena | Probability of capturing Hydraena calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hydrobiidae | Probability of capturing Hydrobiidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hydrobius | Probability of capturing Hydrobius calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hydrochus | Probability of capturing Hydrochus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hydroporus | Probability of capturing Hydroporus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hydroptila | Probability of capturing Hydroptila calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Hydrotrupes | Probability of capturing Hydrotrupes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ilybius | Probability of capturing Ilybius calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ironodes | Probability of capturing Ironodes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ischnura | Probability of capturing Ischnura calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Isogenoides | Probability of capturing Isogenoides calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Isonychia | Probability of capturing Isonychia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Isoperla | Probability of capturing Isoperla calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Juga | Probability of capturing Juga calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Kathroperla | Probability of capturing Kathroperla calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Kogotus | Probability of capturing Kogotus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Laccobius | Probability of capturing Laccobius calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Lara | Probability of capturing Lara calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Lepidostoma | Probability of capturing Lepidostoma calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Lestes | Probability of capturing Lestes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Lethocerus | Probability of capturing Lethocerus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Leucotrichia | Probability of capturing Leucotrichia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Leucrocuta | Probability of capturing Leucrocuta calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Libellula | Probability of capturing Libellula calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Limnophila | Probability of capturing Limnophila calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Limonia | Probability of capturing Limonia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Liodessus | Probability of capturing Liodessus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Lymnaea | Probability of capturing Lymnaea calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Malenka | Probability of capturing Malenka calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Marilia | Probability of capturing Marilia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Maruina | Probability of capturing Maruina calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Matriella_Serratella | Probability of capturing Matriella or Serratella calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Megarcys | Probability of capturing Megarcys calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Menetus | Probability of capturing Menetus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Meringodixa | Probability of capturing Meringodixa calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Micrasema | Probability of capturing Micrasema calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Microcylloepus | Probability of capturing Microcylloepus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Molophilus | Probability of capturing Molophilus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Moselia | Probability of capturing Moselia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Muscidae | Probability of capturing Muscidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Mystacides | Probability of capturing Mystacides calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Namamyia | Probability of capturing Namamyia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Narpus | Probability of capturing Narpus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Nectopsyche | Probability of capturing Nectopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Nematoda | Probability of capturing Nematoda calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Nematomorpha | Probability of capturing Nematomorpha calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Nemotelus | Probability of capturing Nemotelus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Nemoura | Probability of capturing Nemoura calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Neohermes | Probability of capturing Neohermes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Neophylax | Probability of capturing Neophylax calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Neoplasta | Probability of capturing Neoplasta calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Neothremma | Probability of capturing Neothremma calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Neotrichia | Probability of capturing Neotrichia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Nerophilus | Probability of capturing Nerophilus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Nixe | Probability of capturing Nixe calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Nothotrichia | Probability of capturing Nothotrichia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ochrotrichia | Probability of capturing Ochrotrichia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ochthebius | Probability of capturing Ochthebius calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Octogomphus_specularis | Probability of capturing Octogomphus or specularis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Oecetis | Probability of capturing Oecetis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Oemopteryx | Probability of capturing Oemopteryx calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Oligochaeta | Probability of capturing Oligochaeta calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Oligophlebodes | Probability of capturing Oligophlebodes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Onocosmoecus | Probability of capturing Onocosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ophiogomphus | Probability of capturing Ophiogomphus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Optioservus | Probability of capturing Optioservus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ordobrevia | Probability of capturing Ordobrevia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Oreodytes | Probability of capturing Oreodytes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Oreogeton | Probability of capturing Oreogeton calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ormosia | Probability of capturing Ormosia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Orohermes | Probability of capturing Orohermes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Oroperla | Probability of capturing Oroperla calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Orthocladiinae | Probability of capturing Orthocladiinae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Osobenus | Probability of capturing Osobenus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ostracoda | Probability of capturing Ostracoda calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ostrocada | Probability of capturing Ostrocada calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Oxyethira | Probability of capturing Oxyethira calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Palaeagapetus | Probability of capturing Palaeagapetus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Paltothemis | Probability of capturing Paltothemis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Paraleptophlebia | Probability of capturing Paraleptophlebia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Paraleuctra | Probability of capturing Paraleuctra calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Paraperla | Probability of capturing Paraperla calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Parapsyche | Probability of capturing Parapsyche calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Parthina | Probability of capturing Parthina calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Pedicia | Probability of capturing Pedicia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Pedomoecus | Probability of capturing Pedomoecus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Peltodytes | Probability of capturing Peltodytes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Pericoma_Telmatoscopus | Probability of capturing Pericoma or Telmatoscopus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Perlinodes | Probability of capturing Perlinodes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Perlomyia | Probability of capturing Perlomyia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Petrophila | Probability of capturing Petrophila calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Physa_Physella | Probability of capturing Physa or Physella calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Plumiperla | Probability of capturing Plumiperla calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Podmosta | Probability of capturing Podmosta calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Podonominae | Probability of capturing Podonominae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Polycentropus | Probability of capturing Polycentropus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Postelichus | Probability of capturing Postelichus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Probezzia | Probability of capturing Probezzia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Procloeon | Probability of capturing Procloeon calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Prodiamesinae | Probability of capturing Prodiamesinae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Progomphus | Probability of capturing Progomphus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Prostoia | Probability of capturing Prostoia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Prostoma | Probability of capturing Prostoma calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Protoptila | Probability of capturing Protoptila calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Psephenus | Probability of capturing Psephenus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Pseudolimnophila | Probability of capturing Pseudolimnophila calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Psychoda | Probability of capturing Psychoda calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Psychoglypha | Probability of capturing Psychoglypha calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Psychomyia | Probability of capturing Psychomyia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Pteronarcella | Probability of capturing Pteronarcella calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Pteronarcys | Probability of capturing Pteronarcys calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Ptychopteridae | Probability of capturing Ptychopteridae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Rhabdomastix | Probability of capturing Rhabdomastix calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Rhithrogena | Probability of capturing Rhithrogena calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Rhizelmis | Probability of capturing Rhizelmis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Rhyacophila | Probability of capturing Rhyacophila calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Rickera | Probability of capturing Rickera calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Sanfilippodytes | Probability of capturing Sanfilippodytes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Scirtidae | Probability of capturing Scirtidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Sialis | Probability of capturing Sialis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Sierraperla | Probability of capturing Sierraperla calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Sigara | Probability of capturing Sigara calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Silvius | Probability of capturing Silvius calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Simulium | Probability of capturing Simulium calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Siphlonurus | Probability of capturing Siphlonurus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Skwala | Probability of capturing Skwala calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Soliperla | Probability of capturing Soliperla calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Soyedina | Probability of capturing Soyedina calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Sphaeriidae | Probability of capturing Sphaeriidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Sphaeromatidae | Probability of capturing Sphaeromatidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Sphaeromias | Probability of capturing Sphaeromias calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Staphylinidae | Probability of capturing Staphylinidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Stenocolus | Probability of capturing Stenocolus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Stictotarsus | Probability of capturing Stictotarsus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Stilobezzia | Probability of capturing Stilobezzia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Stratiomys | Probability of capturing Stratiomys calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Stygobromus | Probability of capturing Stygobromus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Suwallia | Probability of capturing Suwallia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Sweltsa | Probability of capturing Sweltsa calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Syrphidae | Probability of capturing Syrphidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Tabanus_Atylotus | Probability of capturing Tabanus or Atylotus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Taenionema | Probability of capturing Taenionema calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Tanypodinae | Probability of capturing Tanypodinae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Thaumaleidae | Probability of capturing Thaumaleidae calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Timpanoga | Probability of capturing Timpanoga calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Tinodes | Probability of capturing Tinodes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Tipula | Probability of capturing Tipula calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Triaenodes | Probability of capturing Triaenodes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Trichoclinocera | Probability of capturing Trichoclinocera calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Tricoryhyphes | Probability of capturing Tricoryhyphes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Tricorythodes | Probability of capturing Tricorythodes calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Triznaka | Probability of capturing Triznaka calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Tropisternus | Probability of capturing Tropisternus calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Turbellaria | Probability of capturing Turbellaria calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Uvarus_subtilis | Probability of capturing Uvarus or subtilis calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Visoka | Probability of capturing Visoka calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Wiedemannia | Probability of capturing Wiedemannia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Wormaldia | Probability of capturing Wormaldia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Yoraperla | Probability of capturing Yoraperla calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Yphria | Probability of capturing Yphria calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Zaitzevia | Probability of capturing Zaitzevia calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Zapada | Probability of capturing Zapada calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_CaptureProb_Zoniagrion | Probability of capturing Zoniagrion calculated by the California Stream Condition Index (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Clinger_PercentTaxa | Observed percent clinger taxa | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Clinger_PercentTaxa_predicted | Predicted percent clinger taxa | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Clinger_PercentTaxa_score | Score for percent clinger taxa metric | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Coleoptera_PercentTaxa | Observed percent Coleoptera taxa | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Coleoptera_PercentTaxa_predicted | Predicted percent Coleoptera taxa | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Coleoptera_PercentTaxa_score | Score for percent Coleoptera taxa metric | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Count | Total number of organisms in the sample. If purge=T, the post-purge number is shown. A minimum number has not been established, but samples with low values should be evaluated with caution. | 0 | Bioassessment | | | | | | 2017-05-08 |
CSCI_E | The sum of all capture probabilities greater than 0.5 at a site. Interpreted as the total number of common taxa expected at a site. | 0 | Bioassessment | | | | | | 2017-05-08 |
CSCI_EPT_PercentTaxa | Observed percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_EPT_PercentTaxa_predicted | Predicted percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_EPT_PercentTaxa_score | Scored percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Intolerant_Percent | Observed percent intolerant individuals (CTV<3) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Intolerant_Percent_predicted | Predicted percent intolerant individuals | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Intolerant_Percent_score | Score for percent intolerant individuals metric | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Mean_O | The number of common taxa (i.e., capture probability greater than 0.5) observed at a site, averaged across iterations. | 0 | Bioassessment | | | | | | 2017-05-08 |
CSCI_MMI | The pMMI score, averaged across 20 iterations. A minimum threshold has not been established, but low values should be considered indicative of degradation. | 0 | Bioassessment | | | | | | 2017-05-08 |
CSCI_MMI_Percentile | The percentile of the pMMI score, relative to the reference distribution. A minimum threshold has not been established, but low values should be considered indicative of degradation. | 0 | Bioassessment | | | | | | 2017-05-08 |
CSCI_Number_of_MMI_Iterations | Number of subsamples used to calculate the pMMI. If the count is less than 500, no subsampling is performed, and this field will show 1. Otherwise, 20 subsamples are performed. | 0 | Bioassessment | | | | | | 2017-05-08 |
CSCI_Number_of_OE_Iterations | Number of subsamples used to calculate the O/E. If the total number of unambiguous taxa is less than 500, no subsampling is performed, and this field will show 1. Otherwise, 20 subsamples are performed. | 0 | Bioassessment | | | | | | 2017-05-08 |
CSCI_OoverE | O/E, calculated as Mean_O divided by E. | 0 | Bioassessment | | | | | | 2017-05-08 |
CSCI_OoverE_Percentile | The percentile of the O/E score, relative to the reference distribution. A minimum threshold has not been established, but low values should be considered indicative of degradation. | 0 | Bioassessment | | | | | | 2017-05-08 |
CSCI_Pcnt_Ambiguous_Individuals | Percent of the total number of individuals excluded from O/E calculation. A maximum number has not been established, but samples with high values should be evaluated with caution. | 0 | Bioassessment | | | | | | 2017-05-08 |
CSCI_Pcnt_Ambiguous_Taxa | Percent of the total number of FinalIDs excluded from O/E calculation. A maximum number has not been established, but samples with high values should be evaluated with caution. | 0 | Bioassessment | | | | | | 2017-05-08 |
CSCI_Percentile | The percentile of CSCI score, relative to the reference distribution | 0 | Habitat | | | | | | 2016-06-21 |
CSCI_ProbGroup1 | Probability of membership in Group 1 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_ProbGroup10 | Probability of membership in Group 10 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_ProbGroup11 | Probability of membership in Group 11 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_ProbGroup2 | Probability of membership in Group 2 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_ProbGroup3 | Probability of membership in Group 3 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_ProbGroup4 | Probability of membership in Group 4 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_ProbGroup5 | Probability of membership in Group 5 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_ProbGroup6 | Probability of membership in Group 6 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_ProbGroup7 | Probability of membership in Group 7 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_ProbGroup8 | Probability of membership in Group 8 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_ProbGroup9 | Probability of membership in Group 9 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Shredder_Taxa | Observed number of shredder taxa | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Shredder_Taxa_predicted | Predicted number of shredder taxa | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Shredder_Taxa_score | Score for shredder taxa metric | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Taxonomic_Richness | Observed taxonomic richness | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Taxonomic_Richness_predicted | Predicted taxonomic richness | 0 | Bioassessment | | | | | | 2021-01-28 |
CSCI_Taxonomic_Richness_score | Score for taxonomic richness metric | 0 | Bioassessment | | | | | | 2021-01-28 |
Cumylphenol, 4- | 4-Cumylphenol | 599644 | Organics | Phenols | | | | | 2018-07-16 |
Cup | Cup | 0 | Debris | Trash | Plastics | FoodService | | | 2014-11-04 |
Cup, Styrofoam | Cup, Styrofoam | 0 | Debris | Trash | Plastics | Bags/Packaging | | | 2014-11-04 |
Cup, Waxed Paper | Cup, Waxed Paper | 0 | Debris | Trash | Plastics | Non-Plastics | | | 2014-11-04 |
Cup/Plate, Plastic | Cups/plates, Plastic | 0 | Debris | Trash | Plastics | | | | 2022-11-02 |
Cup/Plate, Polystryene Foam | Cup/plate, Polystyrene Foam, e.g., Styrofoam | 0 | Debris | Trash | Plastics | | | | 2022-11-02 |
Cup/Plate, Waxed Paper | Cup/plate, Waxed Paper | 0 | Debris | Trash | Non-Plastics | | | | 2022-11-02 |
Cyanazine | Cyanazine | 21725462 | Organics | Pesticides | Pest-Triazines | Herbicides | | | 2007-07-27 |
Cyanide | Cyanide | 57125 | Inorganics | Conventionals | | | | | 2007-07-27 |
Cyanobacteria | Potentially toxigenic (PTOX) genera of cyanobacteria | 0 | | | | | | | 2018-12-05 |
CyanotoxinSampleVolume | Volume of material and liquid in Cyanotoxin sample | 0 | Habitat | | | | | | 2012-09-13 |
Cyantraniliprole | Cyantraniliprole | 736994631 | Organics | Pesticides | Insecticides | | | | 2016-03-10 |
Cyazofamid | Cyazofamid | 120116883 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Cybutryne | Cybutryne | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Cyclaniliprole | Cyclaniliprole | 1031756985 | Organics | | | | | | 2022-10-28 |
Cycloate | Cycloate | 1134232 | Organics | Pesticides | Pest-Carbamates | | | | 2013-07-01 |
Cyfluthrin, beta- | beta-Cyfluthrin | 68359375 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2014-05-15 |
Cyfluthrin, gamma- | gamma-Cyfluthrin | 76703623 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2017-09-15 |
Cyfluthrin, total | Total Cyfluthrin | 68359375 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Cyfluthrin-1 | Cyfluthrin peak 1 | 68359375 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Cyfluthrin-2 | Cyfluthrin peak 2 | 68359375 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Cyfluthrin-2/Cyflurthrin-4 | Cyfluthrin-2/Cyflurthrin-4 | 0 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2013-05-28 |
Cyfluthrin-3 | Cyfluthrin peak 3 | 68359375 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Cyfluthrin-4 | Cyfluthrin peak 4 | 68359375 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Cyhalofop-butyl | Cyhalofop-butyl | 122008859 | Organics | Pesticides | Herbicides | | | | 2016-03-10 |
Cyhalothrin, gamma- | gamma-Cyhalothrin | 76703623 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2014-03-20 |
Cyhalothrin, lambda-1 | lambda-Cyhalothrin, peak 1 or Warrior-1 | 91465086 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2014-03-19 |
Cyhalothrin, lambda-2 | lambda-Cyhalothrin, peak 2 or Warrior-2 | 91465086 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2014-03-19 |
Cyhalothrin, Total | Total Cyhalothrin | 68085858 | | | | | | | 2022-02-11 |
Cyhalothrin, Total lambda- | Total lambda-Cyhalothrin, sum peaks 1 & 2 | 91465086 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2014-03-19 |
Cyhalothrin-d6, Total lambda-(Surrogate) | Surrogate: Total lambda-Cyhalothrin-d6 | 0 | Organics | Pesticides | | | | | 2018-03-21 |
Cylindrospermopsin | Cylindrospermopsin | 0 | Microbiological | Cyanotoxins | | | | | 2012-05-22 |
Cymene, p- | p-Cymene | 0 | Organics | VOCs | | | | | 2014-01-28 |
Cymoxanil | Cymoxanil | 57966957 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Cypermethrin, Total | Total Cypermethrin, sum peaks 1,2,3 & 4 | 52315078 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2013-05-28 |
Cypermethrin-1 | Cypermethrin peak 1 | 67375308 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Cypermethrin-13C6(Surrogate) | Surrogate: Cypermethrin-13C6 | 0 | Organics | Pesticides | Insecticides | Pyrethroids | | | 2014-01-29 |
Cypermethrin-2 | Cypermethrin peak 2 | 65731842 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Cypermethrin-2/Cypermethrin-4 | Cypermethrin-2/Cypermethrin-4 | 0 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2013-05-28 |
Cypermethrin-3 | Cypermethrin peak 3 | 71697591 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Cypermethrin-4 | Cypermethrin peak 4 | 52315078 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Cyprazine | Cyprazine | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Cyproconazole | Cyproconazole | 94361065 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Cyprodinil | Cyprodinil | 121552612 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
d13C_VPDB | Delta 13C, relative to Vienna Pee Dee Belemnite | 0 | Organics | IsotopicSignature | | | | | 2015-05-07 |
d15N_Air-N2 | Delta 15N, relative to Atmospheric Nitrogen | 0 | Organics | IsotopicSignature | | | | | 2015-05-07 |
d34S_VCDT | Delta 34S, relative to Vienna Canyon Diablo Troilite | 0 | Organics | IsotopicSignature | | | | | 2015-05-07 |
Dacthal | Dacthal | 1861321 | Organics | Pesticides | Pest-OCHs | | | | 2007-07-27 |
Dacthal acid metabolites | Dacthal acid metabolites | 0 | Organics | Pesticides | | | | | 2017-04-10 |
Dacthal Monoacid | Dacthal Monoacid | 887547 | Organics | Pesticides | | | | | 2017-04-10 |
Dairies Extent | Dairies Extent | 0 | Habitat | | | | | | 2019-05-07 |
Dairies Intensity | Dairies Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Dairies Proximity | Dairies Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Dam Extent | Dam Extent | 0 | Habitat | | | | | | 2019-05-07 |
Dam Intensity | Dam Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Dam Proximity | Dam Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Dams | Dams | 0 | Habitat | | | | | | 2009-08-20 |
Dazomet | Dazomet | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
DBCE(Surrogate) | Surrogate: Dibutylchlorendate | 1770805 | Organics | Pesticides | Pest-OCHs | | | | 2007-07-27 |
DCBP(p,p') | p,p'-Dichlorobenzophenone (DCBP) | 90982 | Organics | Pesticides | Pest-OCHs | | | | 2007-07-27 |
DDD(o,p') | o,p'-DDD | 53190 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
DDD(o,p')(Surrogate) | Surrogate: o,p'-DDD | 53190 | Organics | Pesticides | OrganochlorinePesticides | Semi-VOAs | | | 2016-03-02 |
DDD(o,p')/PCB 118 | o,p'-DDD/PCB 118 | 0 | Organics | Pesticides/PCBs | | | | | 2014-01-28 |
DDD(p,p') | p,p'-DDD | 72548 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
DDD(p,p')(Surrogate) | Surrogate: p,p'-DDD | 72548 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2016-03-02 |
DDD(p,p')-13C12(IsoDilAnalogue) | Isotopic Dilution Analogue: DDD(p,p')-13C12 | 0 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
DDD-13C(p,p')(Surrogate) | Surrogate: p,p'-DDD-C13 | 0 | Organics | Pesticides | | | | | 2018-03-04 |
DDD-d8(p,p')(Surrogate) | Surrogate: p,p'-DDD-d8 | 0 | Organics | Pesticides | | | | | 2013-05-29 |
DDE(o,p') | o,p'-DDE | 3424826 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
DDE(o,p')(Surrogate) | Surrogate: o,p'-DDE | 0 | Organics | Pesticides | | | | | 2010-07-14 |
DDE(o,p')-13C12(IsoDilAnalogue) | Isotopic Dilution Analogue: DDE(o,p')-13C12 | 0 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
DDE(p,p') | p,p'-DDE | 72559 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
DDE(p,p')(Surrogate) | Surrogate: p,p'-DDE | 0 | Organics | Pesticides | | | | | 2010-07-14 |
DDE(p,p')/PCB 087 | p,p'-DDE/PCB 087 | 0 | Organics | Pesticides/PCBs | | | | | 2014-01-28 |
DDE(p,p')-13C12(IsoDilAnalogue) | Isotopic Dilution Analogue: DDE(p,p')-13C12 | 201612502 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
DDE-13C12(p,p')(Surrogate) | Surrogate: DDE-13C12(p,p') | 201612502 | Organics | | | | | | 2022-10-27 |
DDMS(p,p') | p,p'-DDMS | 0 | Organics | Pesticides | | | | | 2011-08-22 |
DDMU(p,p') | p,p'-DDMU | 1022226 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2011-11-28 |
DDT(o,p') | o,p'-DDT | 789026 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
DDT(o,p')(Surrogate) | Surrogate: o,p'-DDT | 0 | Organics | Pesticides | | | | | 2010-07-14 |
DDT(o,p')-13C12(IsoDilAnalogue) | Isotopic Dilution Analogue: DDT(o,p')-13C12 | 0 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
DDT(p,p') | p,p'-DDT | 50293 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
DDT(p,p')(Surrogate) | Surrogate: p,p'-DDT | 0 | Organics | Pesticides | | | | | 2010-07-14 |
DDT(p,p')/PCB 187 | p,p'-DDT/PCB 187 | 0 | Organics | Pesticides/PCBs | | | | | 2014-01-28 |
DDT(p,p')-13C12(IsoDilAnalogue) | Isotopic Dilution Analogue: DDT(p,p')-13C12 | 104215841 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
Dead Domestic Animals | Dead Domestic Animals | 0 | Debris | Trash | Non-Plastics | Marine Origin | | | 2014-11-04 |
Deaminated metribuzin (DA) | Deaminated metribuzin (DA) | 0 | Organics | Pesticides | | | | | 2017-04-20 |
Debris Lines/Silt-Laden Vegetation Extent | Debris Lines/Silt-Laden Vegetation Extent | 0 | Habitat | | | | | | 2019-05-07 |
Debris Lines/Silt-Laden Vegetation Intensity | Debris Lines/Silt-Laden Vegetation Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Debris Lines/Silt-Laden Vegetation Proximity | Debris Lines/Silt-Laden Vegetation Proximity | 0 | Habitat | | | | | | 2019-05-07 |
DebrisLandUse_Commercial | DebrisLandUse_Commercial | 0 | Habitat | Debris | | | | | 2014-11-04 |
DebrisLandUse_Industrial | DebrisLandUse_Industrial | 0 | Habitat | Debris | | | | | 2014-11-04 |
DebrisLandUse_LimitedTimeParking | DebrisLandUse_LimitedTimeParking | 0 | Habitat | Debris | | | | | 2014-11-04 |
DebrisLandUse_OpenSpace | DebrisLandUse_OpenSpace | 0 | Habitat | Debris | | | | | 2014-11-04 |
DebrisLandUse_Park | DebrisLandUse_Park | 0 | Habitat | Debris | | | | | 2014-11-04 |
DebrisLandUse_ParkingLot | DebrisLandUse_ParkingLot | 0 | Habitat | Debris | | | | | 2014-11-04 |
DebrisLandUse_Residential | DebrisLandUse_Residential | 0 | Habitat | Debris | | | | | 2014-11-04 |
Decabromodiphenyl Ethane | Decabromodiphenyl Ethane | 84852539 | Organics | FlameRetardants | | | | | 2013-05-29 |
Decabromodiphenylethane | Decabromodiphenylethane (DBDPE) | 84852539 | Organics | FlameRetardants | | | | | 2014-03-13 |
Decafluorobiphenyl(Surrogate) | Surrogate: Decafluorobiphenyl | 434902 | Organics | PAHs | SVOCs | | | | 2016-03-02 |
Decalin | Decalin | 91178 | Organics | VOCs | | | | | 2014-01-28 |
Decalin, C1- | C1-Decalin | 0 | Organics | VOCs | | | | | 2014-01-28 |
Decalin, C2- | C2-Decalin | 0 | Organics | VOCs | | | | | 2014-01-28 |
Decalin, C3- | C3-Decalin | 0 | Organics | VOCs | | | | | 2014-01-28 |
Decalin, C4- | C4-Decalin | 0 | Organics | VOCs | | | | | 2014-01-28 |
Decamethylcyclopentasiloxane | Decamethylcyclopentasiloxane | 541026 | | | | | | | 2021-05-19 |
Decane, 2-phenyl- | 2-Phenyl-decane | 0 | Organics | VOCs | | | | | 2016-05-20 |
Decane, 3-phenyl- | 3-Phenyl-decane | 0 | Organics | VOCs | | | | | 2016-05-20 |
Decane, 4-phenyl- | 4-Phenyl-decane | 0 | Organics | VOCs | | | | | 2016-05-20 |
Decane, 5-phenyl- | 5-Phenyl-decane | 0 | Organics | VOCs | | | | | 2016-05-20 |
Decane, n- | n-Decane | 0 | Organics | Alkanes | | | | | 2014-01-28 |
Dechlorane 601 | Dechlorane 601 | 0 | Organics | FlameRetardants | | | | | 2014-03-13 |
Dechlorane 602 | Dechlorane 602 | 31107445 | Organics | FlameRetardants | | | | | 2014-03-13 |
Dechlorane 603 | Dechlorane 603 | 0 | Organics | FlameRetardants | | | | | 2014-03-13 |
Dechlorane 604 | Dechlorane 604 | 0 | Organics | FlameRetardants | | | | | 2014-03-13 |
Dechlorane 604 Component B | Dechlorane 604 Component B | 0 | Organics | FlameRetardants | | | | | 2014-03-13 |
Dechlorane Plus Mono Adduct | Dechlorane Plus Mono Adduct (DPMA) | 0 | Organics | FlameRetardants | | | | | 2014-03-13 |
Dechlorane Plus, anti- | anti-Dechlorane Plus (anti-DP) | 13560899 | Organics | FlameRetardants | | | | | 2010-07-15 |
Dechlorane Plus, syn- | syn-Dechlorane Plus (syn-DP) | 13560899 | Organics | FlameRetardants | | | | | 2010-07-15 |
Dechlorane Plus, Total | Total Dechlorane Plus (DP) | 13560899 | Organics | FlameRetardants | | | | | 2014-03-13 |
Dehydronifedipine | Dehydronifedipine | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Delta 13C | Delta 13C | 0 | Organics | Statistic | | | | | 2014-01-28 |
Delta 15N | Delta 15N | 0 | Organics | Statistic | | | | | 2014-01-28 |
Delta 15N - baseline corrected | Delta 15N - baseline corrected | 0 | Organics | Statistic | | | | | 2014-01-28 |
Deltamethrin | Deltamethrin | 52918635 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Deltamethrin/Tralomethrin | Deltamethrin/Tralomethrin | 0 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2010-08-18 |
Deltamethrin-d6, Total(Surrogate) | Surrogate: Total Deltamethrin-d6 | 0 | | | | | | | 2021-08-20 |
Demeton, Total | Total Demeton | 0 | Organics | Pesticides | Pest-Ops | | | | 2010-05-18 |
Demeton-O | Demeton-O | 298033 | Organics | Pesticides | | | | | 2016-05-20 |
Demeton-s | Demeton-s | 126750 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Density | Density of Sample | 0 | Habitat | | | | | | 2007-07-27 |
Deposits | Deposits | 0 | Habitat | | | | | | 2014-04-17 |
Desethyl-Atrazine | Desethyl-Atrazine | 6190654 | Organics | Pesticides | Pest-Triazines | | | | 2009-01-12 |
Desethyl-desisopropyl-atrazine | Desethyl-desisopropyl-atrazine | 3397624 | Organics | Pesticides | Pest-Triazines | | | | 2013-05-20 |
Desisopropyl-Atrazine | Desisopropyl-Atrazine | 1007289 | Organics | Pesticides | Pest-Triazines | | | | 2009-01-12 |
Desmedipham | Desmedipham | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Desmethyldiltiazem | Desmethyldiltiazem | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Desmethyl-LR | Desmethyl-LR | 120011667 | Microbiological | Cyanotoxins | | | | | 2012-05-22 |
Desmethyl-RR | Desmethyl-RR | 0 | Microbiological | Cyanotoxins | | | | | 2012-05-22 |
Desmetryn | Desmetryn | 1014693 | Organics | Pesticides | Pest-Triazines | | | | 2009-01-12 |
Desnitro-imidacloprid | Desnitro-imidacloprid | 115970177 | Organics | Pesticides | Insecticides | Neonics | | | 2017-10-05 |
Desthio-prothioconazole | Desthio-prothioconazole | 120983644 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Detergent | Detergent | 0 | FieldObservations | | | | | | 2015-06-26 |
Deuterium/Hydrogen Ratio | Deuterium/Hydrogen Ratio | 7782390 | Isotopes | | | | | | 2013-05-20 |
Di(2-ethylhexyl) phosphate | Di(2-ethylhexyl) phosphate (DEHP) | 298077 | Organics | FlameRetardants | | | | | 2014-03-13 |
Diallate | Diallate (Avadex) | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Diaminochlorotriazine (DACT) | Diaminochlorotriazine (DACT) | 0 | Organics | Pesticides | | | | | 2017-04-20 |
Diazepam | Diazepam | 439145 | Organics | PPCPs | | | | | 2010-04-26 |
Diazepam-d5(Surrogate) | Surrogate: Diazepam-d5 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Diazinon | Diazinon | 333415 | Organics | Pesticides | Pest-OPs | | | | 2007-07-27 |
Diazinon(Surrogate) | Surrogate: Diazinon | 0 | Organics | Pesticides | OrganophosphatePest. | OrganochlorinePesticides | | | 2011-04-07 |
Diazinon-d10(Surrogate) | Surrogate: Diazinon-d10 | 100155473 | Organics | SVOC | Insecticide | | | | 2023-08-17 |
Diazoxon | Diazoxon | 962583 | Organics | Pesticides | OrganophosphatePest. | OrganochlorinePesticides | | | 2011-07-15 |
Dibenz(a,h)anthracene | Dibenz(a,h)anthracene | 53703 | Organics | PAHs | SVOCs | HMW_PAH | | | 2013-05-28 |
Dibenz(a,h)anthracene, C1- | C1-Dibenz(a,h)anthracene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Dibenz(a,h)anthracene, C2- | C2-Dibenz(a,h)anthracene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Dibenz(a,h)anthracene, C3- | C3-Dibenz(a,h)anthracene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Dibenz(a,h)anthracene-d14(Surrogate) | Surrogate: Dibenz(a,h)anthracene-d14 | 53703 | Organics | PAHs | | | | | 2016-03-02 |
Dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene | Dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene | 0 | | | | | | | 2019-04-23 |
Dibenzofuran | Dibenzofuran | 132649 | Organics | SVOCs | Insecticides | | | | 2007-07-27 |
Dibenzothiophene | Dibenzothiophene | 132650 | Organics | PAHs | SVOCs | | | | 2007-07-27 |
Dibenzothiophene-d8(Surrogate) | Surrogate: Dibenzothiophene-d8 | 33262292 | Organics | PAHs | SVOCs | | | | 2007-07-27 |
Dibenzothiophenes, C1- | C1-Dibenzothiophenes | 0 | Organics | PAHs | SVOCs | | | | 2010-06-21 |
Dibenzothiophenes, C2- | C2-Dibenzothiophenes | 0 | Organics | PAHs | SVOCs | | | | 2010-06-21 |
Dibenzothiophenes, C3- | C3-Dibenzothiophenes | 0 | Organics | PAHs | SVOCs | | | | 2010-06-21 |
Dibenzothiophenes, C4- | C4-Dibenzothiophenes | 0 | Organics | PAHs | Alkylated PAHs | | | | 2018-07-24 |
Dibromo-2,3-dichlorophenyl-hexachloro-norbornene, 4,6- | 4,6-Dibromo-2,3-dichlorophenyl-hexachloro-norbornene (Br2Cl2-DEC604) | 0 | Organics | FlameRetardants | | | | | 2015-07-16 |
Dibromo-3-Chloropropane, 1,2- | 1,2-Dibromo-3-Chloropropane (DBCP) | 96128 | Organics | VOCs | | | | | 2013-05-28 |
Dibromo-4-(1,2-dibromoethyl)cyclohexane, alpha-1,2- | alpha-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (alpha-DBE-DBCH) | 3322938 | Organics | FlameRetardants | | | | | 2015-07-16 |
Dibromo-4-(1,2-dibromoethyl)cyclohexane, beta-1,2- | beta-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (beta-DBE-DBCH) | 3322938 | Organics | FlameRetardants | | | | | 2015-07-16 |
Dibromo-4-(1,2-dibromoethyl)cyclohexane, gamma-1,2- | gamma-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (gamma-DBE-DBCH) | 3322938 | Organics | FlameRetardants | | | | | 2015-07-16 |
Dibromo-4-Cyanophenyl Octanoate, 2,6- | 2,6-Dibromo-4-Cyanophenyl Octanoate | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Dibromo-4-hydroxybenzonitrile, 3,5- | 3,5-Dibromo-4-hydroxybenzonitrile (Bromoxynil) | 1689845 | Organics | SVOCs | | | | | 2013-05-20 |
Dibromoaldrin | Dibromoaldrin (DBALD) | 0 | Organics | FlameRetardants | | | | | 2015-07-16 |
Dibromobiphenyl, 4,4'-(Surrogate) | Surrogate: 4,4'-Dibromobiphenyl | 92864 | Organics | | | | | | 2022-10-27 |
Dibromochloromethane | Dibromochloromethane | 124481 | Organics | VOCs | | | | | 2007-07-27 |
Dibromoethane, 1,2- | 1,2-Dibromoethane | 106934 | Organics | VOCs | Insecticides | | | | 2007-07-27 |
Dibromofluoromethane | Dibromofluoromethane | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dibromofluoromethane(Surrogate) | Surrogate: Dibromofluoromethane | 186857 | Organics | VOCs | | | | | 2007-07-27 |
Dibromomethane | Dibromomethane | 74953 | Organics | VOCs | | | | | 2007-07-27 |
Dibromooctafluorobiphenyl(Surrogate) | Surrogate: Dibromooctafluorobiphenyl | 10386842 | Organics | Pesticides | OrganochlorinePesticides | | | | 2013-05-30 |
Dibromooctafluorobiphenyl, 4,4'-(Surrogate) | Surrogate: 4,4'-Dibromooctafluorobiphenyl (DBOFB) | 10386842 | Organics | Pesticides | Pest-OCHs | | | | 2016-03-02 |
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)DB-608 | Surrogate: 4,4?-Dibromooctafluorobiphenyl run on column DB-608 | 10386842 | Organics | Pesticides | Pest-OCHs | | | | 2016-03-02 |
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)HP-5 | Surrogate: 4,4?-Dibromooctafluorobiphenyl run on column HP-5 | 10386842 | Organics | Pesticides | Pest-OCHs | | | | 2016-03-02 |
Dibromooctafluorobiphenyl, 4-4'-(Surrogate) | Surrogate: 4-4' Dibromooctafluorobiphenyl (DBOFB) | 10386800 | Organics | Pesticides | Pest-OCHs | | | | 2013-05-28 |
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)DB-608 | Surrogate: 4,4?-dibromooctafluorobiphenyl run on column DB-608 | 10386800 | Organics | Pesticides | Pest-OCHs | | | | 2013-05-28 |
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)HP-5 | Surrogate: 4,4?-dibromooctafluorobiphenyl run on column HP-5 | 10386800 | Organics | Pesticides | Pest-OCHs | | | | 2013-05-28 |
Dibromophenyl-hexachloro-norbornene | Dibromophenyl-hexachloro-norbornene (Br2-DEC604) | 0 | Organics | FlameRetardants | | | | | 2015-07-16 |
Dibromopropane, 1,2-(Surrogate) | Surrogate: 1,2-Dibromopropane | 78751 | Organics | | | | | | 2021-10-19 |
Dibutyl phosphate | Dibutyl phosphate (DBP) | 107664 | Organics | FlameRetardants | | | | | 2014-03-13 |
Dibutylchlorendate | Dibutylchlorendate | 0 | Organics | Pesticides | | | | | 2011-05-11 |
Dibutylchlorendate(Surrogate) | Surrogate: Dibutylchlorendate (DBCE) | 1770805 | Organics | Pesticides | Pest-Pyrethroids | | | | 2013-05-28 |
Dibutyltin as Sn | Dibutyltin as Sn (DBT) | 683181 | Organics | Organotins | Biocide | | | | 2010-06-21 |
Dicamba | Dicamba (2,5-Dichloro-6-methoxybenzoic Acid) | 1918009 | Organics | Herbicides | | | | | 2013-05-28 |
Dicamba, diethanolamine salt | Dicamba, diethanolamine salt | 25059783 | Organics | Pesticides | | | | | 2017-04-20 |
Dicamba, dimethylamine salt | Dicamba, dimethylamine salt | 2300665 | Organics | Pesticides | | | | | 2017-04-20 |
Dichlofenthion | Dichlofenthion | 97176 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Dichlofenthion(Surrogate) | Surrogate: Dichlofenthion | 97176 | Organics | Pesticides | | | | | 2015-08-21 |
Dichlone | Dichlone | 117806 | Organics | Pesticides | Fungicides | | | | 2016-10-25 |
Dichloran | Dichloran (Botran) (Benzenamine, 2,6-dichloro-4-nitro-) | 99309 | Pyrethroid Pesticides | | | | | | 2015-07-02 |
Dichloro-2 butene, cis 1,4- | Cis-1,4-dichloro-2 butene | 0 | Organics | | | | | | 2018-02-13 |
Dichloro-2 butene, trans 1,4- | Trans-1,4-dichloro-2 butene | 110576 | | | | | Organics | | 2016-07-29 |
Dichloroacetate(Surrogate) | Surrogate: Dichloroacetate | 79436 | Organics | Acids | | | | | 2016-03-02 |
Dichloroaniline, 3,4- | 3,4-Dichloroaniline | 0 | | | | | | | 2019-01-23 |
Dichloroaniline, 3,5- | 3,5-Dichloroaniline | 626437 | Organics | Pesticides | | | | | 2016-03-10 |
Dichlorobenzenamine, 3,4- | 3,4-Dichlorobenzenamine (3,4-DCA) | 95761 | Pesticides | | | | | | 2013-05-31 |
Dichlorobenzene, 1,2- | 1,2-Dichlorobenzene | 95501 | Organics | VOCs | SVOCs | Herbicides | | | 2007-07-27 |
Dichlorobenzene, 1,2-(Surrogate) | Surrogate: 1,2-Dichlorobenzene | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dichlorobenzene, 1,3- | 1,3-Dichlorobenzene | 541731 | Organics | VOCs | SVOCs | Insecticides | | | 2007-07-27 |
Dichlorobenzene, 1,3-(Surrogate) | Surrogate: 1,3-Dichlorobenzene | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dichlorobenzene, 1,4- | 1,4-Dichlorobenzene | 106467 | Organics | VOCs | SVOCs | Insecticides | | | 2007-07-27 |
Dichlorobenzene, 1,4-(Surrogate) | Surrogate: 1,4-Dichlorobenzene | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dichlorobenzene-d4, 1,2- | 1,2-Dichlorobenzene-d4 | 2199691 | Organics | VOCs | | | | | 2016-05-20 |
Dichlorobenzene-d4, 1,2-(Surrogate) | Surrogate: 1,2-Dichlorobenzene-d4 | 2199691 | Organics | VOCs | | | | | 2016-05-20 |
Dichlorobenzene-d4, 1,4-(Surrogate) | Surrogate: 1,4-Dichlorobenzene-d4 | 3855821 | Organics | VOCs | SVOCs | Insecticides | | | 2013-05-28 |
Dichlorobenzidine, 3,3'- | 3,3'-Dichlorobenzidine | 91941 | Organics | Semi-VOAs | | | | | 2011-05-11 |
Dichlorobenzidine, 3,3'-(Surrogate) | Surrogate: 3,3'-Dichlorobenzidine | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dichlorobenzoic Acid, 3,5- | 3,5-Dichlorobenzoic Acid | 51365 | Organics | VOCs | | | | | 2016-05-20 |
Dichlorobenzoic Acid, 3,5-(Surrogate) | Surrogate: 3,5-Dichlorobenzoic Acid | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dichlorobenzonitrile, 2,6- | 2,6-Dichlorobenzonitrile (Dichlobenil) | 1194656 | Organics | Pesticides | Herbicides | | | | 2016-10-25 |
Dichlorobenzophenone(p,p') | p,p'-Dichlorobenzophenone | 0 | Organics | Pesticides | | | | | 2014-01-28 |
Dichlorodifluoromethane | Dichlorodifluoromethane | 75718 | Organics | VOCs | | | | | 2007-07-27 |
Dichloroethane, 1,1- | 1,1-Dichloroethane | 75343 | Organics | VOCs | | | | | 2007-07-27 |
Dichloroethane, 1,2- | 1,2-Dichloroethane | 107062 | Organics | VOCs | | Insecticides | | | 2007-07-27 |
Dichloroethane-d4, 1,2-(Surrogate) | Surrogate: 1,2-Dichloroethane-d4 | 17060070 | Organics | VOCs | | | | | 2007-07-27 |
Dichloroethylene, 1,1- | 1,1-Dichloroethylene (1,1-Dichloroethene) | 75354 | Organics | VOCs | | | | | 2013-05-28 |
Dichloroethylene, cis 1,2- | cis-1,2-Dichloroethylene (cis-1,2-Dichloroethene) | 156592 | Organics | VOCs | | | | | 2013-05-28 |
Dichloroethylene, Total 1,2- | Total 1,2-Dichloroethylene | 0 | Organics | VOCs | | | | | 2017-03-29 |
Dichloroethylene, trans 1,2- | trans-1,2-Dichloroethylene (trans-1,2-Dichloroethene) | 156605 | Organics | VOCs | | | | | 2013-05-28 |
Dichlorophenol, 2,4- | 2,4-Dichlorophenol | 120832 | Organics | SVOCs | Phenols | Chlorinated Phenols | | | 2007-07-27 |
Dichlorophenol, 2,4-(Surrogate) | Surrogate: 2,4-Dichlorophenol | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dichlorophenol, 2,6- | 2,6-Dichlorophenol | 87650 | Organics | SVOCs | Phenols | Chlorinated Phenols | | | 2016-08-19 |
Dichlorophenoxy)propionic acid isooctyl ester, 2-(2,4- | 2-(2,4-dichlorophenoxy)propionic acid isooctyl ester | 28631358 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid 2-ethylhexyl ester, 2,4- | 2,4-Dichlorophenoxyacetic acid 2-ethylhexyl ester (2,4-D 2-ethylexyl ester) | 1928434 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid alkanolamine salts, 2,4- | 2,4-Dichlorophenoxyaceticc Acid alkanolamine salts (2,4-D alkanolamine salts) | 0 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid butoxyethanol ester, 2,4- | 2,4-Dichlorophenoxyaceticc Acid butoxyethanol ester (2,4-D Butoxyethyl ester) | 1929733 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid butyl ester, 2,4- | 2,4-Dichlorophenoxyaceticc Acid butyl ester (2,4-D butyl ester) | 94804 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid diethanolamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid diethanolamine salt (2,4-D diethanolamine salt) | 5742198 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid diethylamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid diethylamine salt (2,4-D diethylamine salt) | 20940378 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid dimethylamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid dimethylamine salt (2,4-D dimethylamine salt) | 2008391 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid dodecylamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid dodecylamine salt (2,4-D dodecylamine salt) | 2212546 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid isooctyl ester, 2,4- | 2,4-Dichlorophenoxyaceticc Acid isooctyl ester (2,4-D isooctyl ester) | 25168267 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid Methyl Ester, 2,4- | 2,4-Dichlorophenoxyacetic acid Methyl ester (2,4-D 2-Methyl ester) | 1928387 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid n,n-dimethyloleyl-linoleyamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid n,n-dimethyloleyl-linoleyamine salt (2,4-D n,n-dimethyloleyl-linoleyamine salt) | 55256321 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid n-oleyl-1, 2,4-3-propylenediamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid n-oleyl-1,3-propylenediamine salt (2,4-D n-oleyl-1,3-propylenediamine salt) | 2212591 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid octyl ester, 2,4- | 2,4-Dichlorophenoxyaceticc Acid octyl ester (2,4-D octyl ester) | 1917971 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid propyl ester, 2,4- | 2,4-Dichlorophenoxyaceticc Acid propyl ester (2,4-D propyl ester) | 1928616 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid propyleneglycolbutylether ester, 2,4- | 2,4-Dichlorophenoxyacetic Acid propylene glycol butyl ether ester (2,4-D propylene glycol butyl ether ester) | 1320189 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid tetradecylamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid tetradecylamine salt (2,4-D tetradecylamine salt) | 28685189 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid triethylamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid triethylamine salt (2,4-D triethylamine salt) | 2646788 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxyacetic Acid, 2,3-(Surrogate) | Surrogate: 2,3-Dichlorophenoxyacetic Acid (2,3-D) | 2976741 | Organics | VOCs | | | | | 2016-05-20 |
Dichlorophenoxyacetic Acid, 2,4- | 2,4-Dichlorophenoxyacetic Acid (2,4-D) | 94757 | Organics | Herbicides | | | | | 2013-05-28 |
Dichlorophenoxyacetic Acid, 2,4-(Surrogate) | Surrogate: 2,4-Dichlorophenoxyacetic Acid (2,4-D) | 94757 | Organics | VOCs | | | | | 2016-05-20 |
Dichlorophenoxybutyric Acid dimethylamine salt, 4-(2,4- | 4-2,4-Dichlorophenoxybutyric Acid dimethylamine salt | 2758421 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxybutyric Acid isooctyl ester, 4-(2,4- | 4-2,4-Dichlorophenoxybutyric Acid isooctyl ester | 1320156 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorophenoxybutyric Acid Methyl Ester, 2,4- | 2,4-Dichlorophenoxybutyric Acid Methyl Ester (2,4-DB Methyl Ester) | 0 | Organics | Herbicides | | | | | 2013-05-20 |
Dichlorophenoxybutyric Acid, 2,4- | 2,4-Dichlorophenoxybutyric Acid (2,4-DB) | 94826 | Organics | Herbicides | | | | | 2013-05-28 |
Dichlorophenoxybutyric Acid, 2,4-(Surrogate) | Surrogate: 2,4-Dichlorophenoxybutyric Acid (2,4-DB) | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dichlorophenyl isocyanate, 3,4- | 3,4-Dichlorophenyl isocyanate | 102363 | Organics | | | | | | 2018-07-16 |
Dichlorophenyl Urea, 3,4- | 3,4-Dichlorophenyl Urea (DCPU) | 2327028 | Pesticides | | | | | | 2013-05-31 |
Dichlorophenyl-3-methyl Urea, 3,4- | 3,4-Dichlorophenyl-3-methyl Urea (DCPMU) | 3567622 | Pesticides | | | | | | 2013-05-31 |
Dichlorophenylacetic Acid, 2,4- | 2,4-Dichlorophenylacetic Acid | 19719289 | Organics | Herbicides | | | | | 2016-05-20 |
Dichlorophenylacetic Acid, 2,4- (Surrogate) | Surrogate: 2,4-Dichlorophenylacetic Acid | 19719289 | Organics | Herbicides | | | | | 2013-05-28 |
Dichloroprop | Dichlorprop (2-(2,4-Dichlorophenoxy)propanoic Acid) | 120365 | Organics | Herbicides | | | | | 2013-05-28 |
Dichloroprop, dimethylamine salt | Dichloroprop, dimethylamine salt | 2008391 | Organics | Pesticides | | | | | 2017-04-20 |
Dichloropropane, 1,2- | 1,2-Dichloropropane | 78875 | Organics | VOCs | Insecticides | Nematocides | | | 2007-07-27 |
Dichloropropane, 1,3- | 1,3-Dichloropropane | 142289 | Organics | VOCs | | | | | 2007-07-27 |
Dichloropropane, 2,2- | 2,2-Dichloropropane | 594207 | Organics | VOCs | | | | | 2007-07-27 |
Dichloropropene, 1,1- | 1,1-Dichloropropene | 563586 | Organics | VOCs | | | | | 2007-07-27 |
Dichloropropene, 1,3- | 1,3-Dichloropropene | 0 | | | | | | | 2016-12-23 |
Dichloropropene, cis 1,3- | cis-1,3-Dichloropropene | 10061015 | Organics | VOCs | | | | | 2007-07-27 |
Dichloropropene, Total 1,3- | Total 1,3-Dichloropropene | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dichloropropene, trans 1,3- | trans-1,3-Dichloropropene | 10061026 | Organics | VOCs | | | | | 2007-07-27 |
Dichloropropionic Acid, 2,2- | 2,2-Dichloropropionic Acid (Dalapon) | 75990 | Organics | Herbicides | | | | | 2013-05-28 |
Dichloro-pyridine-2-carboxylic Acid, 3,6- | 3,6-Dichloro-pyridine-2-carboxylic Acid (Clopyralid) | 1702176 | Organics | Herbicides | | | | | 2013-05-28 |
Dichlorotrifluoroethane | Dichlorotrifluoroethane (Freon 123) | 306832 | Organics | VOCs | | | | | 2017-04-12 |
Dichlorotrifluoromethane | Dichlorotrifluoromethane | 0 | Organics | VOCs | | | | | 2016-01-26 |
Dichlorprop, butoxyethyl ester | Dichlorprop, butoxyethyl ester | 53404312 | Organics | Pesticides | | | | | 2017-04-10 |
Dichlorvos | Dichlorvos | 62737 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Dichrotophos | Dichrotophos | 0 | Organics | Pesticides | | | | | 2016-05-20 |
Diclofenac | Diclofenac (2-(2-(2,6-Dichlorophenylamino)phenyl)acetic Acid) | 15307865 | Organics | PPCPs | | | | | 2013-05-27 |
Diclofop-Methyl | Diclofop-Methyl | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Dicofol | Dicofol | 115322 | Organics | Pesticides | Pest-OCHs | | | | 2007-07-27 |
Dicrotophos | Dicrotophos | 141662 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Di-dechlorinated Dechlorane Plus | Di-dechlorinated Dechlorane Plus (C10-DP) | 0 | Organics | FlameRetardants | | | | | 2014-03-13 |
Dieldrin | Dieldrin | 60571 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
Dieldrin(Surrogate) | Surrogate: Dieldrin | 0 | Organics | Pesticides | | | | | 2008-11-17 |
Dienochlor | Dienochlor | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
Diesel Fuel | Diesel Fuel | 0 | Organics | | | | | | 2015-06-25 |
Diethatyl-Ethyl | Diethatyl-Ethyl | 38727558 | Organics | Pesticides | Herbicides | | | | 2007-07-27 |
Diethyl Phosphate | Diethyl Phosphate (DEP) | 598027 | Organics | FlameRetardants | | | | | 2015-07-16 |
Diethyl phthalate | Diethyl phthalate | 84662 | Organics | SVOCs | | | | | 2007-07-27 |
Diethyl-3-methyl-benzamide, N,N- | N,N-Diethyl-3-methyl-benzamide | 134623 | Organics | PPCPs | | | | | 2010-04-26 |
Diethyl-3-methyl-benzamide-d7, N,N-(Surrogate) | Surrogate: N,N-Diethyl-3-methyl-benzamide-d7 | 0 | Organics | PPCPs | | | | | 2016-10-31 |
Diethylaniline, 2,6- | 2,6-Diethylaniline | 579668 | Organics | Pesticides | | | | | 2017-04-10 |
Diethylstilbestrol | Diethylstilbestrol | 0 | Organics | PPCPs | | | | | 2014-01-28 |
Difenoconazole | Difenoconazole | 119446683 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Difenzoquat Methylsulfate | Difenzoquat Methylsulfate | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Diflubenzuron | Diflubenzuron (Difluron) | 35367385 | Organics | Pesticides | | | | | 2013-06-27 |
Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether, 5,6-(Surrogate) | Surrogate: 5,6-Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether | 886748330 | Organics | PBDEs | | | | | 2013-05-28 |
Difluoro-2,2?,3,3?,4,5,5?,6?-Octabromodiphenyl Ether 4?,6-(Surrogate) | Surrogate: 4?,6-Difluoro-2,2?,3,3?,4,5,5?,6?-Octabromodiphenyl Ether | 0 | Organics | PBDEs | | | | | 2013-05-28 |
Difluorobenzene, 1,4- | 1,4-Difluorobenzene | 0 | Organics | VOCs | | | | | 2016-05-20 |
Difluorobenzene, 1,4-(Surrogate) | Surrogate: 1,4-Difluorobenzene | 540363 | Organics | VOCs | Semi-VOAs | | | | 2014-01-29 |
Digoxigenin | Digoxigenin | 1672464 | Organics | PPCPs | | | | | 2010-04-26 |
Digoxin | Digoxin | 20830755 | Organics | PPCPs | | | | | 2010-04-26 |
Diisopropyl Ether | Diisopropyl Ether | 108203 | Organics | SVOCs | | | | | 2013-05-20 |
Dike/Levee Extent | Dike/Levee Extent | 0 | Habitat | | | | | | 2019-05-07 |
Dike/Levee Intensity | Dike/Levee Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Dike/Levee Proximity | Dike/Levee Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Diltiazem | Diltiazem | 42399417 | Organics | PPCPs | | | | | 2010-04-26 |
Dimethipin | Dimethipin | 55290647 | | | | | Organics | | 2023-08-15 |
Dimethoate | Dimethoate | 60515 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Dimethomorph | Dimethomorph | 110488705 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Dimethyl phosphate | Dimethyl Phosphate (DMP) | 813785 | Organics | FlameRetardants | | | | | 2015-07-16 |
Dimethyl phthalate | Dimethyl phthalate | 131113 | Organics | SVOCs | | | | | 2007-07-27 |
Dimethyl-2-nitrobenzene, 1,3- | 1,3-Dimethyl-2-nitrobenzene | 81209 | Organics | | | | | | 2011-10-25 |
Dimethyl-2-nitrobenzene, 1,3-(Surrogate) | Surrogate: 1,3-Dimethyl-2-nitrobenzene (2,6-Dimethylnitrobenzene) | 81209 | Organics | VOCs | | | | | 2016-03-02 |
Dimethylarsinic Acid | Dimethylarsinic Acid | 0 | Organics | Herbicides | | | | | 2014-01-28 |
Dimethylchrysene, 5,9- | 5,9-Dimethylchrysene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Dimethyldibenzothiophene, 2,4- | 2,4-Dimethyldibenzothiophene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Dimethylfluorene, 1,7- | 1,7-Dimethylfluorene | 442660 | Organics | PAHs | Semi-VOAs | | | | 2010-07-08 |
Dimethylnaphthalene, 1,2- | 1,2-Dimethylnaphthalene | 573988 | Organics | PAHs | Semi-VOAs | | | | 2010-07-08 |
Dimethylnaphthalene, 1,2,6- | 1,2,6-Dimethylnaphthalene | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dimethylnaphthalene, 2,6- | 2,6-Dimethylnaphthalene | 581420 | Organics | PAHs | SVOCs | LMW_PAH | | | 2007-07-27 |
Dimethylnaphthalene, 2,6-(Surrogate) | Surrogate: 2,6-Dimethylnaphthalene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Dimethylnaphthalene-d12, 2,6-(Surrogate) | Surrogate: 2,6-Dimethylnaphthalene-d12 | 581420 | Organics | PAHs | | | | | 2016-03-02 |
Dimethylphenanthrene, 1,5/1,7- | 1,5-Dimethylphenanthrene/1,7-Dimethylphenanthrene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Dimethylphenanthrene, 1,7- | 1,7-Dimethylphenanthrene | 483874 | Organics | PAHs | | | | | 2010-09-23 |
Dimethylphenanthrene, 1,8- | 1,8-Dimethylphenanthrene | 0 | Organics | PAHs | LMW_PAH | | | | 2018-07-24 |
Dimethylphenanthrene, 2,6- | 2,6-Dimethylphenanthrene | 0 | Organics | PAHs | LMW_PAH | | | | 2018-07-24 |
Dimethylphenanthrene, 3,6- | 3,6-Dimethylphenanthrene | 1576676 | Organics | PAHs | SVOCs | LMW_PAH | | | 2007-07-27 |
Dimethylphenol, 2,4- | 2,4-Dimethylphenol | 105679 | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | | 2007-07-27 |
Dimethylphenol, 2,4-(Surrogate) | Surrogate: 2,4-Dimethylphenol | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Dimethylxanthine, 1,7- | 1,7-Dimethylxanthine | 611596 | Organics | PPCPs | | | | | 2010-04-26 |
Di-n-butyl Phthalate | Di-n-butyl Phthalate | 84742 | Organics | SVOCs | Endocrine Disruptors | | | | 2013-05-28 |
Di-n-butyl Phthalate-d4(Surrogate) | Surrogate: Di-n-butyl Phthalate-d4 | 0 | Organics | SVOCs | | | | | 2014-01-29 |
Dinitro-2-methylphenol, 4,6- | 4,6-Dinitro-2-methylphenol | 534521 | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | | 2007-07-27 |
Dinitro-2-methylphenol, 4,6-(Surrogate) | Surrogate: 4,6-Dinitro-2-methylphenol | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Dinitrophenol, 2,4- | 2,4-Dinitrophenol | 51285 | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | | 2007-07-27 |
Dinitrophenol, 2,4-(Surrogate) | Surrogate: 2,4-Dinitrophenol | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Dinitrotoluene, 2,4- | 2,4-Dinitrotoluene | 121142 | Organics | SVOCs | | | | | 2007-07-27 |
Dinitrotoluene, 2,4-(Surrogate) | Surrogate: 2,4-Dinitrotoluene | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Dinitrotoluene, 2,6- | 2,6-Dinitrotoluene | 606202 | Organics | SVOCs | | | | | 2007-07-27 |
Dinitrotoluene, 2,6-(Surrogate) | Surrogate: 2,6-Dinitrotoluene | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Di-n-octyl Phthalate | Di-n-octyl Phthalate | 117840 | Organics | SVOCs | | | | | 2013-05-28 |
Dinoseb | Dinoseb (2,4-Dinitro-6-sec-butylphenol) | 88857 | Organics | Herbicides | | | | | 2013-07-01 |
Dinotefuran | Dinotefuran | 165252700 | Organics | Pesticides | Insecticides | | | | 2016-03-10 |
Dinotefuran-13C5(Surrogate) | Surrogate: Dinotefuran-13C5 | 0 | Organics | Pesticides | | | | | 2018-08-07 |
Di-n-propylnitrosamine | Di-n-propylnitrosamine | 0 | Organics | SVOCs | | | | | 2014-01-29 |
Dioxa-3H-Perfluorononanoate Acid, 4,8- | 4,8-Dioxa-3H-Perfluorononanoate Acid | 919005144 | Organics | PFAS | | | | | 2019-08-28 |
Dioxacarb | Dioxacarb (2-(1,3-Dioxolan-2-yl)phenyl Methylcarbamate) | 6988212 | Organics | Pesticides | Pest-Carbamates | Insecticides | | | 2013-07-01 |
Dioxane, 1,4- | 1,4-Dioxane | 0 | | | | | | | 2016-12-23 |
Dioxathion | Dioxathion | 87342 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Diphenamid | Diphenamid | 957517 | Organics | Pesticides | Herbicides | | | | 2007-07-27 |
Diphenamid(Surrogate) | Surrogate: Diphenamid | 957517 | Organics | Pesticides | | | | | 2016-03-02 |
Diphenhydramine | Diphenhydramine | 58731 | Organics | PPCPs | | | | | 2010-04-26 |
Diphenyl Ether | Diphenyl Ether | 0 | Organics | VOCs | | | | | 2014-02-05 |
Diphenyl phosphate | Diphenyl phosphate (DPP) | 838857 | Organics | FlameRetardants | | | | | 2014-03-13 |
Diphenylamine | Diphenylamine | 122394 | Organics | Pesticides | | | | | 2014-01-28 |
Diphenylanthracene, 9,10- | 9,10-Diphenylanthracene | 0 | | | | | | | 2019-06-11 |
Diphenylguanidine,1,3- | 1,3-diphenylguanidine | 102067 | Organics | Amidines | | | | | 2019-12-11 |
Diphenylhydrazine, 1,2- | 1,2-Diphenylhydrazine | 0 | Organics | PPCPs | | | | | 2014-01-28 |
Diphenylhydrazine, 1,2-(Surrogate) | Surrogate: 1,2-Diphenylhydrazine | 0 | Organics | VOCs | | | | | 2016-05-20 |
Diphenylphthalate(Surrogate) | Surrogate: Diphenylphthalate | 0 | Organics | VOCs | | | | | 2014-02-05 |
Dipropetryn | Dipropetryn | 4147517 | Organics | Pesticides | Pest-Triazines | | | | 2009-01-12 |
Diquat | Diquat | 85007 | Organics | Pesticides | | | | | 2008-11-17 |
Direct Septic/Sewage Discharge Extent | Direct Septic/Sewage Discharge Extent | 0 | Habitat | | | | | | 2019-05-07 |
Direct Septic/Sewage Discharge Intensity | Direct Septic/Sewage Discharge Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Direct Septic/Sewage Discharge Proximity | Direct Septic/Sewage Discharge Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Discharge | Discharge from a calculation | 0 | WaterQualityMeasurements | | | | | | 2007-07-27 |
Discharge Direct Measurement | Discharge Direct Measurement | 0 | WaterQualityMeasurements | Ancillary | | | | | 2014-02-05 |
DischargeMeasurementMethod | Method used to collect discharge (velocity) measurement | 0 | WaterQualityMeasurements | | | | | | 2012-05-22 |
DischargeMeasurementRating | Code qualifying the stream discharge measurement quality in relation to the actual flow | 0 | WaterQualityMeasurements | | | | | | 2012-05-22 |
Disodium methylarsonate | Disodium methylarsonate | 144218 | Organics | Pesticides | | | | | 2017-04-20 |
Dissolved Inorganic Carbon | Dissolved Inorganic Carbon (DIC) | 7440440 | Inorganics | Conventionals | | | | | 2016-05-20 |
Dissolved Organic Carbon | Dissolved Organic Carbon (DOC) | 0 | Inorganics | Conventionals | | | | | 2007-07-27 |
Distance from Bank | Distance from Bank | 0 | Habitat | | | | | | 2009-08-20 |
Distance to Bankfull | Distance from the wetted edge to the Bankfull mark | 0 | Habitat | | | | | | 2012-09-13 |
Distance, Float | Float distance of observed object | 0 | Habitat | | | | | | 2009-08-20 |
Distance, Sampled | Distance sampled within a given waterbody | 0 | Habitat | | | | | | 2012-09-13 |
Disulfoton | Disulfoton | 298044 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Disulfoton Sulfone | Disulfoton Sulfone | 0 | Organics | Pesticides | | | | | 2014-01-28 |
Ditches/Canals Extent | Ditches/Canals Extent | 0 | Habitat | | | | | | 2019-05-07 |
Ditches/Canals Intensity | Ditches/Canals Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Ditches/Canals Proximity | Ditches/Canals Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Dithiopyr | Dithiopyr | 97886458 | Organics | Pesticides | Herbicides | | | | 2016-03-10 |
Diuron | Diuron | 330541 | Organics | Pesticides | Pest-Carbamates | Herbicides | | | 2007-07-27 |
Diuron-d6(Surrogate) | Surrogate: Diuron-d6 | 1007536675 | Organics | Pesticides | Pest-Carbamates | Herbicides | | | 2021-10-19 |
DMPA | DMPA (O-(2,4-Dichlorophenyl)-O'-Methyl-N-Isopropylphosphoro amido thioate) | 299854 | Organics | Pesticides | | | | | 2017-04-20 |
DNOC, sodium salt | DNOC, Sodium salt (4,6-Dinitro-2-methylphenol sodium salt) | 2312767 | Organics | Pesticides | | | | | 2017-04-10 |
Docohexaenoic Acid | Docohexaenoic Acid | 0 | Organics | Omega Fatty Acid | | | | | 2016-05-20 |
Docosahexaenoic Acid | Docosahexaenoic Acid | 6217545 | Organics | Omega Fatty Acid | | | | | 2012-09-12 |
Docosane, n- | n-Docosane | 0 | Organics | Alkanes | | | | | 2014-01-28 |
Docosapentaenoic Acid | Docosapentaenoic Acid | 0 | Organics | Omega Fatty Acid | | | | | 2013-05-28 |
Dodecamethylcyclohexasiloxane | Dodecamethylcyclohexasiloxane | 540976 | | | | | | | 2021-05-19 |
Dodecane, 2-phenyl- | 2-Phenyl-dodecane | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dodecane, 3-phenyl- | 3-Phenyl-dodecane | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dodecane, 4-phenyl- | 4-Phenyl-dodecane | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dodecane, 5-phenyl- | 5-Phenyl-dodecane | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dodecane, 6-phenyl- | 6-Phenyl-dodecane | 0 | Organics | VOCs | | | | | 2016-05-20 |
Dodecane, n- | n-Dodecane | 0 | Organics | Alkanes | | | | | 2014-01-28 |
Dodecylammonium Methanearsonate | Dodecylammonium Methanearsonate | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Dodemorph | Dodemorph | 0 | Organics | Pesticides | Fungicides | | | | 2017-04-04 |
Dodine | Dodine | 0 | Organics | Pesticides | Fungicides | | | | 2017-04-04 |
Dominant Benthic Substrate | Dominant Benthic Substrate - Specific to EMAP BA | 0 | Habitat | | | | | | 2009-08-20 |
Dominant Land Use | Dominant Land Use | 0 | Habitat | | | | | | 2009-08-20 |
DominantSubstrate | DominantSubstrate | 0 | FieldObservations | Habitat | | | | | 2009-08-20 |
Domoic Acid | Domoic Acid | 14277975 | Microbiological | Cyanotoxins | | | | | 2013-05-28 |
Dotriacontane, n- | n-Dotriacontane | 544854 | Organics | Alkanes | | | | | 2013-05-01 |
Doxycycline | Doxycycline | 564250 | Organics | PPCPs | | | | | 2012-05-22 |
Dredging | Dredging | 0 | Habitat | | | | | | 2009-08-20 |
Dry | Dry | 0 | Habitat | | | | | | 2009-08-20 |
Dry Weight | Dry Weight | 0 | Tissue | Ancillary | | | | | 2014-02-05 |
Dry Weight Standard Error | Dry Weight Standard Error | 0 | Tissue | Ancillary | | | | | 2014-02-05 |
Dumping | Dumping using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
DW_Algae | Total Dry Weight primarily of Algae but other items may be weighed | 0 | | | | | | | 2020-01-14 |
E. coli | Escherichia coli | 0 | Microbiological | Pathogens | Conventionals | | | | 2007-07-27 |
E. Coli O157:H7 | Escherichia Coli O157:H7 strain | 0 | Microbiological | Pathogens | Conventionals | | | | 2013-05-28 |
Eicosane, n- | n-Eicosane | 0 | Organics | Alkanes | | | | | 2014-01-28 |
Eicosapentaenoate | Eicosapentaenoate | 0 | Organics | Omega Fatty Acid | | | | | 2012-09-12 |
ElectricalConductivity | Electrical Conductivity | 0 | WaterQualityMeasurements | Conventionals | | | | | 2007-07-27 |
Elevation Difference | Elevation Difference | 0 | Habitat | | | | | | 2009-08-20 |
Embeddedness | Embeddedness | 0 | Habitat | | | | | | 2009-08-20 |
Emergent | Emergent (%) | 0 | Toxicity | | | | | | 2007-07-27 |
Emergent juvenile | Emergent juvenile (#) | 0 | Toxicity | | | | | | 2007-07-27 |
Enalapril | Enalapril | 75847733 | Organics | PPCPs | | | | | 2010-04-26 |
Enalapril-d5(Surrogate) | Surrogate: Enalapril-d5 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
End Time | Time (hh:mm) when a given event ended | 0 | Habitat | | | | | | 2012-09-13 |
Endosulfan I | Endosulfan I (alpha-Endosulfan) | 959988 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2013-05-28 |
Endosulfan I(Surrogate) | Surrogate: Endosulfan I (alpha-Endosulfan) | 0 | Organics | Pesticides | | | | | 2014-01-28 |
Endosulfan I-d4(Surrogate) | Surrogate: Endosulfan I-d4 (alpha-Endosuflan-d4) | 0 | Organics | Pesticides | | | | | 2013-05-27 |
Endosulfan II | Endosulfan II (beta-Endosulfan) | 33213659 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2013-05-28 |
Endosulfan II(Surrogate) | Surrogate: Endosulfan II (beta-Endosulfan) | 0 | Organics | Pesticides | | | | | 2014-01-28 |
Endosulfan II-d4(Surrogate) | Surrogate: Endosulfan II-d4 | 0 | Organics | | | | | | 2017-03-06 |
Endosulfan Sulfate | Endosulfan Sulfate | 1031078 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2013-05-28 |
Endosulfan Sulfate-13C9(Surrogate) | Surrogate: Endosulfan Sulfate-13C9 | 0 | Organics | VOCs | | | | | 2016-05-20 |
Endothall | Endothall | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Endothall, dipotassium salt | Endothall, dipotassium salt | 2164070 | Organics | Pesticides | | | | | 2017-04-10 |
Endothall, mono (N,N-diethyl alkylamine) salt | Endothall, mono (N,N-diethyl alkylamine) salt | 0 | Organics | Pesticides | | | | | 2017-04-10 |
Endothall, mono (N,N-dimethyl alkylamine) salt | Endothall, mono (N,N-dimethyl alkylamine) salt | 0 | Organics | Pesticides | | | | | 2017-04-10 |
Endrin | Endrin | 72208 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
Endrin Aldehyde | Endrin Aldehyde | 7421934 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
Endrin Aldehyde(Surrogate) | Surrogate: Endrin Aldehyde | 0 | Organics | Pesticides | OrganochlorinePesticides | Semi-VOAs | | | 2012-09-07 |
Endrin Ketone | Endrin Ketone | 53494705 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
Endrin Ketone-13C12(IsoDilAnalogue) | Isotopic Dilution Analogue: Endrin Ketone-13C12 | 0 | | | | | | | 2022-07-06 |
Endrin Ketone-13C12(Surrogate) | Surrogate: Endrin Ketone-13C12 | 53494705 | Organics | Pesticides | | | | | 2013-06-17 |
Endrin(Surrogate) | Surrogate: Endrin | 72208 | Organics | Pesticides | | | | | 2016-03-02 |
Endrin-13C12(IsoDilAnalogue) | Isotopic Dilution Analogue: Endrin-13C12 | 0 | | | | | | | 2022-07-06 |
Endrin-13C12(Surrogate) | Surrogate: Endrin-13C12 | 72208 | Organics | Pesticides | | | | | 2016-03-02 |
Enrofloxacin | Enrofloxacin | 93106606 | Organics | PPCPs | | | | | 2010-04-26 |
Enterococcus | Enterococcus | 0 | Microbiological | Pathogens | Conventionals | | | | 2007-07-27 |
Enterovirus | | 0 | | | | | | | 2018-02-13 |
Epitestosterone | Epitestosterone | 481301 | | | | | | | 2018-08-31 |
EPN | EPN | 2104645 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
EPN(Surrogate) | Surrogate: EPN | 2104645 | Organics | Pesticides | OrganophosphatePest. | Semi-VOAs | | | 2013-01-31 |
EPTC | EPTC | 759944 | Organics | Pesticides | Herbicides | | | | 2007-07-27 |
EPTC(Surrogate) | Surrogate: EPTC | 759944 | Organics | Pesticides | Herbicides | | | | 2016-03-02 |
Erythromycin | Erythromycin | 114078 | | | | | | | 2021-05-07 |
Erythromycin-H2O | Erythromycin-H2O | 0 | Organics | PPCPs | | | | | 2012-05-22 |
Erythromycin-H2O-13C2(Surrogate) | Surrogate: Erythromycin-H2O-13C2 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Esfenvalerate | Esfenvalerate | 66230044 | Organics | Pesticides | | | | | 2016-05-20 |
Esfenvalerate/Fenvalerate, Total | Total Esfenvalerate/Fenvalerate, sum peaks 1 & 2 | 51630581 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2013-05-28 |
Esfenvalerate/Fenvalerate-1 | Esfenvalerate/Fenvalerate peak 1 | 51630581 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Esfenvalerate/Fenvalerate-2 | Esfenvalerate/Fenvalerate peak 2 | 66230404 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2007-07-27 |
Esfenvalerate-d6, Total(Surrogate) | Surrogate: Total Esfenvalerate-d6, sum peaks 1 & 2 | 0 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2015-06-10 |
Esfenvalerate-d6-1(Surrogate) | Surrogate: Esfenvalerate-d6 peak 1 | 0 | Organics | Pesticides | Insecticides | Pyrethroids | | | 2012-12-13 |
Esfenvalerate-d6-2(Surrogate) | Surrogate: Esfenvalerate-d6 peak 2 | 0 | Organics | Pesticides | Insecticides | Pyrethroids | | | 2013-10-29 |
Estradiol, 17alpha- | 17alpha-Estradiol | 57910 | | | | | | | 2018-08-31 |
Estradiol, 17beta- | 17beta-Estradiol | 50282 | Organics | PPCPs | | | | | 2013-05-28 |
Estradiol-d3, 17beta-(IsoDilAnalogue) | Isotope Dilution Analogue: 17beta-Estradiol-d3 | 79037379 | Organics | | | | | | 2022-07-22 |
Estriol | Estriol | 50271 | | | | | | | 2018-08-31 |
Estriol-d2(Surrogate) | Surrogate: Estriol-d2 | 53866323 | | | | | | | 2022-05-24 |
Estrone | Estrone | 53167 | Organics | PPCPs | | | | | 2012-08-15 |
Ethaboxam | Ethaboxam | 162650773 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Ethafluralin | Ethalfluralin | 55283686 | Organics | Pesticides | Herbicides | | | | 2013-05-30 |
Ethalfluralin | Ethalfluralin | 55283686 | Organics | Pesticides | Herbicides | | | | 2007-07-27 |
Ethanol | Ethanol (Ethyl Alcohol) | 0 | Organics | Pesticides | | | | | 2017-04-04 |
Ethion | Ethion | 563122 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Ethion monoxon | Ethion monoxon | 17356422 | Organics | Pesticides | | | | | 2017-04-20 |
Ethion(Surrogate) | Surrogate: Ethion | 563122 | Organics | Pesticides | OrganophosphatePest. | OrganochlorinePesticides | | | 2016-03-02 |
Ethofenprox | Ethofenprox | 80844071 | Organics | PPCPs | | | | | 2012-09-13 |
Ethofumesate | Ethofumesate | 0 | Organics | Pesticides | | | | | 2017-04-04 |
Ethoprop | Ethoprop (Prophos) | 13194484 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Ethyl Ether | Ethyl Ether | 60297 | Organics | VOCs | | | | | 2013-05-20 |
Ethyl Perfluorooctane Sulfonamido Acetic Acid, N- | N-Ethyl Perfluorooctane Sulfonamido Acetic Acid (Et-PFOSA-AcOH) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5 (N-EtFOSAA) | 0 | Organics | | | | | | 2022-02-24 |
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(Surrogate) | Surrogate: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5 | 0 | Organics | PFAS | PFC Precursor | | | | 2014-11-03 |
Ethyl Tert-butyl Ether | Ethyl Tert-butyl Ether (ETBE) | 637923 | Organics | VOCs | | | | | 2013-05-28 |
Ethyl-6-methylaniline, 2- | 2-Ethyl-6-methylaniline | 24549062 | Organics | Pesticides | | | | | 2017-04-10 |
Ethylan | Ethylan | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
Ethylbenzene | Ethylbenzene | 100414 | Organics | VOCs | MTBE_BTEX | | | | 2007-07-27 |
Ethylene bis(tetrabromophthalimide) | Ethylene bis(tetrabromophthalimide) (EBTEBPI) | 32588764 | Organics | FlameRetardants | | | | | 2014-03-13 |
Ethylene Glycol | Ethylene Glycol | 107211 | | | | | Organics | | 2016-10-21 |
Ethylene Thiourea | Ethylene Thiourea | 0 | Organics | Pesticides | | | | | 2017-04-04 |
Ethylene/vinyl Acetate Co-polymer Fiber | Ethylene/vinyl acetate copolymer Fiber | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Ethylene/vinyl Acetate Co-polymer Film | Ethylene/vinyl acetate copolymer Film | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Ethylene/vinyl Acetate Co-polymer Foam | Ethylene/vinyl acetate copolymer Foam | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Ethylene/vinyl Acetate Co-polymer Fragment | Ethylene/vinyl acetate copolymer Fragment | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Ethylene/vinyl Acetate Co-polymer Sphere | Ethylene/vinyl acetate copolymer Sphere | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Ethylene-propylene copolymer fragment | Ethylene-propylene copolymer fragment that can be grouped under the plastic category | 0 | Microdebris | Anthropogenic | Plastics | Fragment | | | 2018-06-18 |
Ethylhexyl 2,3,4,5-tetrabromobenzoate, 2- | 2-Ethylhexyl 2,3,4,5-tetrabromobenzoate | 183658277 | Organics | FlameRetardants | | | | | 2010-07-15 |
Ethylparaben | Ethylparaben | 120478 | | | | | | | 2021-05-07 |
Ethyl-perfluorooctanesulfonamide, N- | N-Ethyl-perfluorooctanesulfonamide | 0 | Organics | PFAS | | | | | 2010-02-23 |
Ethyl-perfluorooctanesulfonamide-d5, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Ethyl-perfluorooctanesulfonamide-d5 (N-EtFOSA) | 0 | Organics | | | | | | 2022-03-04 |
Ethyl-perfluorooctanesulfonamide-d5, N-(Surrogate) | Surrogate: Ethyl-perfluorooctanesulfonamide-d5, N- (N-EtFOSA) | 0 | Organics | PFAS | | | | | 2021-06-02 |
Ethyl-perfluorooctanesulfonamidoethanol, N- | N-Ethyl-perfluorooctanesulfonamidoethanol | 0 | Organics | PFAS | | | | | 2010-02-23 |
Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Ethyl-perfluorooctanesulfonamidoethanol-d9 (N-EtFOSE) | 0 | Organics | | | | | | 2022-03-04 |
Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(Surrogate) | Surrogate: Ethyl-perfluorooctanesulfonamidoethanol-d9, N- (N-EtFOSE) | 0 | Organics | PFAS | | | | | 2021-06-02 |
Ethynylestradiol, 17alpha- | 17alpha-Ethynylestradiol | 57636 | | | | | | | 2018-08-31 |
Ethynylestradiol-d4, 17alpha-(IsoDilAnalogue) | Isotope Dilution Analogue: 17alpha-Ethynylestradiol-d4 | 350820063 | Organics | | | | | | 2022-07-22 |
Ethynylestradiol-d4, 17alpha-(Surrogate) | Surrogate: 17alpha-Ethynylestradiol-d4 | 350820063 | | | | | | | 2022-05-24 |
Etoxazole | Etoxazole | 153233911 | Organics | | | | | | 2018-07-16 |
Europium | Europium | 7440531 | Inorganics | | | | | | 2013-05-20 |
Ev_FlowHab | Evenness of flow habitat types physical-habitat metric | 0 | Bioassessment | | | | | | 2021-01-28 |
Evidence of Fire | Evidence of Fire | 0 | Habitat | | | | | | 2009-08-20 |
Evidence of Fire Intensity | Evidence of Fire Intensity - Specific to EMAP BA | 0 | Habitat | | | | | | 2009-08-27 |
Evidence of Illegal Connection | Evidence of Illegal Connection | 0 | | | | | | | 2016-06-13 |
Evidence of Illegal Dumping | Evidence of Illegal Dumping | 0 | | | | | | | 2016-06-13 |
Evidence of Recent Rainfall | Evidence of Recent Rainfall | 0 | Habitat | | | | | | 2009-08-20 |
Evidence of Scour | Site is affected by recent scouring event | 0 | Habitat | FieldObservations | | | | | 2016-02-24 |
E-waste | E-waste | 0 | Debris | Trash | Plastics | Toxic | | | 2014-11-04 |
Excavation Extent | Excavation Extent | 0 | Habitat | | | | | | 2019-05-07 |
Excavation Intensity | Excavation Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Excavation Proximity | Excavation Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Excess Animal Waste Extent | Excess Animal Waste Extent | 0 | Habitat | | | | | | 2019-05-07 |
Excess Animal Waste Intensity | Excess Animal Waste Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Excess Animal Waste Proximity | Excess Animal Waste Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Excess Sediment Input Other Extent | Excess Sediment Input Other Extent | 0 | Habitat | | | | | | 2019-05-07 |
Excess Sediment Input Other Intensity | Excess Sediment Input Other Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Excess Sediment Input Other Proximity | Excess Sediment Input Other Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Excessive Human Visitation Extent | Excessive Human Visitation Extent | 0 | Habitat | | | | | | 2019-05-07 |
Excessive Human Visitation Intensity | Excessive Human Visitation Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Excessive Human Visitation Proximity | Excessive Human Visitation Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Fabric | Fabric | 0 | Debris | Trash | Non-Plastics | Biodegradable | | | 2014-11-04 |
FabricCloth | Fabric Cloth using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Fallow Fields Extent | Fallow Fields Extent | 0 | Habitat | | | | | | 2019-05-07 |
Fallow Fields Intensity | Fallow Fields Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Fallow Fields Proximity | Fallow Fields Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Famoxadone | Famoxadone | 131807573 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Famphur | Famphur | 52857 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Fenamidone | Fenamidone | 161326347 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Fenamiphos | Fenamiphos (Phosphoramidic acid, Isopropyl-, 4-(methylthio)-m-tolyl Ethyl Ester) | 22224926 | Organics | Pesticides | Pest-Ops | Insecticides | | | 2013-05-28 |
Fenamiphos sulfone | Fenamiphos sulfone | 31972448 | Organics | Pesticides | | | | | 2017-04-20 |
Fenamiphos sulfoxide | Fenamiphos sulfoxide | 31972437 | Organics | Pesticides | | | | | 2017-04-20 |
Fenarimol | Fenarimol | 60168889 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Fenbuconazole | Fenbuconazole | 114369436 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Fenbutatin-Oxide | Fenbutatin-Oxide | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
Fenchlorphos | Fenchlorphos (Ronnel) | 299843 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Fenhexamid | Fenhexamid | 126833178 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Fenitrothion | Fenitrothion | 122145 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Fenoxycarb | Fenoxycarb | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
Fenpropathrin | Fenpropathrin (Danitol) | 39515418 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2013-05-28 |
Fenpropathrin-d6(Surrogate) | Surrogate: Fenpropathrin-d6 | 0 | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | | 2017-05-25 |
Fenpyroximate | Fenpyroximate | 134098616 | Organics | Pesticides | Insecticides | | | | 2016-03-10 |
Fensulfothion | Fensulfothion | 115902 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Fenthion | Fenthion (Mercaptophos) | 55389 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Fenuron | Fenuron | 101428 | Organics | Pesticides | Herbicides | | | | 2007-07-27 |
Fenuron trichloroacetate | Fenuron trichloroacetate | 4482557 | Organics | Pesticides | | | | | 2017-04-20 |
Fenvalerate | Fenvalerate | 51630581 | Organics | Pesticides | | | | | 2016-05-20 |
Fenvalerate-d5(Surrogate) | Surrogate: Fenvalerate-d5 | 0 | Organics | Pesticides | Pest-Pyrethroids | | | | 2020-06-26 |
Feral Pig Disturbance Extent | Feral Pig Disturbance Extent | 0 | Habitat | | | | | | 2019-05-07 |
Feral Pig Disturbance Intensity | Feral Pig Disturbance Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Feral Pig Disturbance Proximity | Feral Pig Disturbance Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Ferbam | Ferbam | 0 | Organics | Pesticides | Fungicides | | | | 2017-04-04 |
Fertilization | Fertilization (%) | 0 | Toxicity | | | | | | 2007-07-27 |
Fertilized eggs per nest | Fertilized eggs per nest (#) | 0 | Toxicity | | | | | | 2007-07-27 |
Filling Time | Time to fill a collection device with water | 0 | Habitat | | | | | | 2009-08-27 |
FinalSampleExtVolume | Final post-processing volume | 0 | Laboratory | Ancillary | | | | | 2014-02-05 |
Fine | Fine | 0 | Inorganics | Conventionals | GrainSize | | | | 2011-09-08 |
Fipronil | Fipronil | 120068373 | Organics | Pesticides | Insecticides | | | | 2009-08-19 |
Fipronil Amide | Fipronil Amide | 0 | Organics | Pesticides | Insecticides | | | | 2014-11-03 |
Fipronil Desulfinyl | Fipronil Desulfinyl | 205650653 | Organics | Pesticides | Insecticides | | | | 2013-05-28 |
Fipronil Desulfinyl Amide | Fipronil Desulfinyl Amide | 1115248093 | Organics | Pesticides | Insecticides | | | | 2014-11-03 |
Fipronil Desulfinyl-13C4 15N2(Surrogate) | Surrogate: Fipronil Desulfinyl-13C4 15N2 | 0 | Organics | Pesticides | Fipronils | | | | 2019-06-03 |
Fipronil DetrifluoroMethylsulfinyl | Fipronil DetrifluoroMethylsulfinyl | 120068793 | Organics | Pesticides | Fipronils | | | | 2018-07-26 |
Fipronil Detrifluoromethylsulfinyl-13C4 15N2(Surrogate) | Surrogate: Fipronil Detrifluoromethylsulfinyl-13C4 15N2 | 0 | Organics | Pesticides | Fipronils | | | | 2019-06-03 |
Fipronil Sulfide | Fipronil Sulfide | 120067836 | Organics | Pesticides | Insecticides | | | | 2009-08-19 |
Fipronil Sulfide-13C4 15N2(Surrogate) | Surrogate: Fipronil Sulfide-13C4 15N2 | 0 | Organics | Pesticides | Fipronils | | | | 2019-06-03 |
Fipronil Sulfone | Fipronil Sulfone | 120068362 | Organics | Pesticides | Insecticides | | | | 2013-05-28 |
Fipronil Sulfone-13C4 15N2(Surrogate) | Surrogate: Fipronil Sulfone-13C4 15N2 | 0 | Organics | Pesticides | Fipronils | | | | 2019-06-03 |
Fipronil-13C4 15N2(Surrogate) | Surrogate: Fipronil-13C4 15N2 | 0 | PESTICIDES | Fipronils | | | | | 2016-10-05 |
Fipronil-13C4(Surrogate) | Surrogate: Fipronil-13C4 | 0 | | | | | | | 2021-02-12 |
Fipronil-C13(Surrogate) | Surrogate: Fipronil-C13 | 0 | Organics | Pesticides | | | | | 2018-03-04 |
Fire Breaks Extent | Fire Breaks Extent | 0 | Habitat | | | | | | 2019-05-07 |
Fire Breaks Intensity | Fire Breaks Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Fire Breaks Proximity | Fire Breaks Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Fireworks | Fireworks | 0 | Debris | Trash | Non-Plastics | Toxic | | | 2014-11-04 |
Fish Cover Artificial Structures | Fish Cover/Instream Habitat Complexity ? Other Artificial Structures | 0 | Habitat | | | | | | 2009-08-20 |
Fish Cover Boulders | Fish Cover/Instream Habitat Complexity ? Other Boulders | 0 | Habitat | | | | | | 2009-08-20 |
Fish Cover Filamentous Algae | Fish Cover/Instream Habitat Complexity - Other Filamentous Algae | 0 | Habitat | | | | | | 2009-08-20 |
Fish Cover Live Trees/Roots | Fish Cover/Instream Habitat Complexity ? Other Live Trees or Roots | 0 | Habitat | | | | | | 2009-08-20 |
Fish Cover Macrophytes | Fish Cover/Instream Habitat Complexity - Macrophytes | 0 | Habitat | | | | | | 2009-08-20 |
Fish Cover Overhang.Veg | Fish Cover/Instream Habitat Complexity ? Other Overhanging Vegetation =<1 m of surface | 0 | Habitat | | | | | | 2009-08-20 |
Fish Cover Undercut Banks | Fish Cover/Instream Habitat Complexity ? Other Undercut Banks | 0 | Habitat | | | | | | 2009-08-20 |
Fish Cover Woody Debris <0.3 m | Fish Cover/Instream Habitat Complexity ? Other Woody Debris <0.3 m | 0 | Habitat | | | | | | 2009-08-20 |
Fish Cover Woody Debris >0.3 m | Fish Cover/Instream Habitat Complexity ? Other Woody Debris >0.3 m | 0 | Habitat | | | | | | 2009-08-20 |
Fish Stocking | Fish Stocking | 0 | Habitat | | | | | | 2009-08-20 |
Fishing Line/Net | Fishing Line/Net | 0 | Debris | Trash | Plastics | Miscellaneous | | | 2014-11-04 |
Float Time | Float time of observed object | 0 | Habitat | | | | | | 2009-12-10 |
Floatables | Floatables | 0 | Habitat | | | | | | 2014-04-17 |
Flonicamid | Flonicamid | 158062670 | Organics | Pesticides | Insecticides | | | | 2016-03-10 |
Florpyrauxifen-Benzyl | Florpyrauxifen-Benzyl | 1390661729 | Organics | | | | | | 2022-10-28 |
Flow Diversions Extent | Flow Diversions Extent | 0 | Habitat | | | | | | 2019-05-07 |
Flow Diversions Intensity | Flow Diversions Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Flow Diversions Proximity | Flow Diversions Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Fluazifop-P-butyl | Fluazifop-P-butyl | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Fluazinam | Fluazinam | 79622596 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Flubendiamide | Flubendiamide | 272451657 | Organics | | | | | | 2018-07-16 |
Fluchloralin | Fluchloralin | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Flucythrinate | Flucythrinate | 70124775 | Organics | Pesticides | Pyrethroids | | | | 2011-05-14 |
Fludioxonil | Fludioxonil | 131341861 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Flufenacet | Flufenacet | 142459583 | Organics | Pesticides | Herbicides | | | | 2016-03-10 |
Fluindapyr | Fluindapyr | 1383809877 | Organics | | | | | | 2022-10-28 |
Flumequine | Flumequine | 42835256 | Organics | PPCPs | | | | | 2010-04-26 |
Flumetralin | Flumetralin | 62924703 | Organics | Pesticides | Herbicides | | | | 2016-03-10 |
Flumetsulam | Flumetsulam | 98967409 | Organics | Herbicides | | | | | 2013-05-20 |
Flumioxazin | Flumioxazin | 103361097 | Organics | Pesticides | | | | | 2018-03-21 |
Fluocinonide | Fluocinonide | 356127 | Organics | PPCPs | | | | | 2010-04-26 |
Fluometuron | Fluometuron | 2164172 | Organics | Pesticides | Herbicides | | | | 2007-07-27 |
Fluopicolide | Fluopicolide | 239110157 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Fluopyram | Fluopyram | 658066354 | Organics | Pesticides | Fungicides | | | | 2017-06-07 |
Fluoranthene | Fluoranthene | 206440 | Organics | PAHs | SVOCs | HMW_PAH | | | 2007-07-27 |
Fluoranthene/Pyrenes, C1- | C1-Fluoranthene/Pyrenes | 0 | Organics | PAHs | SVOCs | HMW_PAH | | | 2010-06-21 |
Fluoranthene-d10(Surrogate) | Surrogate: Fluoranthene-d10 | 206440 | Organics | PAHs | | | | | 2012-04-04 |
Fluoranthenes/Pyrenes, C2- | C2-Fluoranthenes/Pyrenes | 0 | Organics | PAHs | | | | | 2014-01-28 |
Fluoranthenes/Pyrenes, C3- | C3-Fluoranthenes/Pyrenes | 0 | Organics | PAHs | | | | | 2014-01-28 |
Fluoranthenes/Pyrenes, C4- | C4-Fluoranthenes/Pyrenes | 0 | Organics | PAHs | Alkylated PAHs | | | | 2018-07-24 |
Fluorene | Fluorene | 86737 | Organics | PAHs | SVOCs | LMW_PAH | | | 2007-07-27 |
Fluorene-d10(Surrogate) | Surrogate: Fluorene-d10 | 0 | Organics | PAHs | | | | | 2014-01-28 |
Fluorenes, C1- | C1-Fluorenes | 0 | Organics | PAHs | SVOCs | LMW_PAH | | | 2010-06-21 |
Fluorenes, C2- | C2-Fluorenes | 0 | Organics | PAHs | SVOCs | LMW_PAH | | | 2010-06-21 |
Fluorenes, C3- | C3-Fluorenes | 0 | Organics | PAHs | SVOCs | LMW_PAH | | | 2010-06-21 |
Fluorescence | Fluorescence | 0 | WaterQualityMeasurements | | | | | | 2012-05-22 |
Fluoridamid | Fluoridamid (Acetamide) | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Fluoride | Fluoride | 16984488 | Inorganics | Conventionals | | | | | 2007-07-27 |
Fluoro-2,3',6-Tribromodiphenyl Ether, 4'-(Surrogate) | Surrogate: 4'-Fluoro-2,3',6-tribromodiphenyl Ether | 863314867 | Organics | PBDEs | | | | | 2013-05-28 |
Fluorobenzene | Fluorobenzene | 462066 | Organics | Organofluorides | | | | | 2010-11-01 |
Fluorobenzene(Surrogate) | Surrogate: Fluorobenzene | 462066 | | | | | | | 2020-07-15 |
Fluorobiphenyl, 2- | 2-Fluorobiphenyl | 321608 | Organics | SVOCs | | | | | 2016-05-20 |
Fluorobiphenyl, 2-(Surrogate) | Surrogate: 2-Fluorobiphenyl | 321608 | Organics | VOCs | | | | | 2016-03-02 |
Fluoroelastomer Fiber | Fluoroelastomer Fiber | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Fluoroelastomer Fiber Bundle | Fluoroelastomer Fiber Bundle | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Fluorophenol, 2- | 2-Fluorophenol | 367124 | Organics | VOCs | | | | | 2016-05-20 |
Fluorophenol, 2-(Surrogate) | Surrogate: 2-Fluorophenol | 367124 | Organics | VOCs | Phenols | non-Chlorinated Phenols | | | 2016-03-02 |
Fluorotelomer Carboxylic Acid, 10:2- | 10:2-Fluorotelomer Carboxylic Acid?(FTCA) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Fluorotelomer Carboxylic Acid, 3:3- | 3:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorohexanoic acid) (3:3 FTCA) | 356025 | Organics | PFAS | | | | | 2021-06-02 |
Fluorotelomer Carboxylic Acid, 5:3- | 5:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorooctanoic acid) (5:3 FTCA) | 914637493 | Organics | PFAS | | | | | 2021-06-02 |
Fluorotelomer Carboxylic Acid, 6:2- | 6:2-Fluorotelomer Carboxylic Acid?(FTCA) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Fluorotelomer Carboxylic Acid, 7:3- | 7:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorodecanoic acid) (7:3 FTCA) | 812704 | Organics | PFAS | | | | | 2021-06-02 |
Fluorotelomer Carboxylic Acid, 8:2- | 8:2-Fluorotelomer Carboxylic Acid?(FTCA) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Fluorotelomer Carboxylic Acid-13C2, 10:2-(Surrogate) | Surrogate: 10:2-Fluorotelomer Carboxylic Acid-13C2 | 0 | Organics | PFAS | PFC Precursor | | | | 2014-11-03 |
Fluorotelomer carboxylic acid-13C2, 6:2-(Surrogate) | Surrogate: 6:2-Fluorotelomer carboxylic acid-13C2 | 0 | Organics | PFAS | | | | | 2014-10-02 |
Fluorotelomer Carboxylic Acid-13C2, 8:2-(Surrogate) | Surrogate: 8:2-Fluorotelomer Carboxylic Acid-13C2 | 0 | Organics | PFAS | PFC Precursor | | | | 2014-11-03 |
Fluorotelomer Sulfonate, 4:2- | 4:2-Fluorotelomer Sulfonate (4:2 FTS) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Fluorotelomer Sulfonate, 6:2- | 6:2-Fluorotelomer Sulfonate (6:2 FTS) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Fluorotelomer Sulfonate, 8:2- | 8:2-Fluorotelomer Sulfonate (8:2 FTS) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Fluorotelomer Sulfonate-13C, 6:2-(Surrogate) | Surrogate: 6:2-Fluorotelomer Sulfonate-13C | 0 | Organics | PFAS | PFC Precursor | | | | 2014-11-03 |
Fluorotelomer Sulfonate-13C2, 4:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 4:2-Fluorotelomer Sulfonate-13C2 (4:2 FTS) | 0 | Organics | | | | | | 2022-03-04 |
Fluorotelomer Sulfonate-13C2, 4:2-(Surrogate) | Surrogate: Fluorotelomer Sulfonate-13C2, 4:2- (4:2 FTS) | 0 | Organics | PFAS | | | | | 2021-06-02 |
Fluorotelomer Sulfonate-13C2, 6:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 6:2-Fluorotelomer Sulfonate-13C2 (6:2 FTS) | 0 | Organics | | | | | | 2022-03-11 |
Fluorotelomer Sulfonate-13C2, 6:2-(Surrogate) | Surrogate: Fluorotelomer Sulfonate-13C2, 6:2- (6:2 FTS) | 0 | Organics | PFAS | | FlameRetardants | | | 2021-08-20 |
Fluorotelomer Sulfonate-13C2, 8:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 8:2-Fluorotelomer Sulfonate-13C2 (8:2 FTS) | 0 | Organics | | | | | | 2022-03-04 |
Fluorotelomer Sulfonate-13C2, 8:2-(Surrogate) | Surrogate: Fluorotelomer Sulfonate-13C2, 8:2- (8:2 FTS) | 0 | Organics | PFAS | | | | | 2021-06-02 |
Fluorotelomer Unsaturated Carboxylic Acid, 10:2- | 10:2-Fluorotelomer Unsaturated Carboxylic Acid?(FTuCA) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Fluorotelomer Unsaturated Carboxylic Acid, 6:2- | 6:2-Fluorotelomer Unsaturated Carboxylic Acid?(FTuCA) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Fluorotelomer Unsaturated Carboxylic Acid, 8:2- | 8:2-Fluorotelomer Unsaturated Carboxylic Acid (FTuCA) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Fluorotelomer Unsaturated Carboxylic Acid-13C2, 10:2-(Surrogate) | Surrogate: 10:2-Fluorotelomer Unsaturated Carboxylic Acid-13C2 | 0 | Organics | PFAS | PFC Precursor | | | | 2014-11-03 |
Fluorotelomer Unsaturated Carboxylic Acid-13C2, 6:2-(Surrogate) | Surrogate: 6:2-Fluorotelomer Unsaturated Carboxylic Acid-13C2 | 0 | Organics | PFAS | PFC Precursor | | | | 2014-11-03 |
Fluoxastrobin | Fluoxastrobin | 193740760 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Fluoxetine | Fluoxetine | 54910893 | Organics | PPCPs | | | | | 2012-05-22 |
Fluoxetine-d5(Surrogate) | Surrogate: Fluoxetine-d5 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Flupyradifurone | Flupyradifurone | 951659408 | Organics | Pesticides | Insecticides | | | | 2018-01-03 |
Fluridone | Fluridone | 59756604 | Organics | Pesticides | | | | | 2008-11-17 |
Fluridone(Surrogate) | Surrogate: Fluridone | 59756604 | Organics | Pesticides | Pest-Pyrethroids | | | | 2010-05-02 |
Flusilazole | Flusilazole | 85509199 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Fluticasone Propionate | Fluticasone Propionate | 80474142 | Organics | PPCPs | | | | | 2013-05-29 |
Flutolanil | Flutolanil | 66332965 | Organics | Fungicides | | | | | 2016-05-20 |
Flutriafol | Flutriafol | 76674210 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Fluvalinate | Fluvalinate | 0 | Organics | Pesticides | | | | | 2016-05-20 |
Fluxapyroxad | Fluxapyroxad | 907204313 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Foam Ball | Foam Ball | 0 | Debris | Trash | Plastics | Miscellaneous | | | 2014-11-04 |
Foliose Algae | Foliose Algae | 0 | Debris | Trash | Non-Plastics | Marine Origin | | | 2014-11-04 |
Folpet | Folpet | 133073 | Organics | Pesticides | Fungicides | | | | 2016-10-25 |
Fonofos | Fonofos (Dyfonate) | 944229 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Fonofos(Surrogate) | Surrogate: Fonofos | 0 | Organics | Pesticides | OrganophosphatePest. | Insecticides | | | 2011-07-15 |
Food Service | Food Service | 0 | Debris | Trash | Plastics | | | | 2014-11-05 |
Food Service, Other | Food Service, Other | 0 | Debris | Trash | Plastics | FoodService | | | 2014-11-04 |
Forest Dominant Age Class | Forest Dominant Age Class | 0 | Habitat | | | | | | 2009-08-20 |
Formaldehyde | Formaldehyde (Methanal) | 0 | Organics | Pesticides | | | | | 2017-04-04 |
Formate | Formate | 0 | Organics | | | | | | 2017-05-03 |
Formate(Surrogate) | Surrogate: Formate | 0 | Organics | | | | | | 2017-08-10 |
Formetanate hydrochloride | Formetanate hydrochloride | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
Fosetyl-al, Technical | Fosetyl-aluminum, Technical | 39148248 | Organics | Pesticides | | | | | 2017-04-10 |
FPOM | Fine particulate organic matter | 0 | Habitat | | | | | | 2012-09-12 |
Furniture | Furniture | 0 | Debris | Trash | Plastics | Non-Plastics | | | 2014-11-04 |
Furosemide | Furosemide | 54319 | Organics | PPCPs | | | | | 2010-04-26 |
Gadolinium | Gadolinium | 7440542 | Inorganics | Metals | | | | | 2018-08-28 |
Gage Height | Water surface level measured against a staff gage within a given waterbody | 0 | Habitat | | | | | | 2012-12-04 |
Galaxolide | Galaxolide | 0 | Organics | Pesticides | | | | | 2008-06-27 |
Galaxolide-d6(Surrogate) | Galaxolide-d6(Surrogate) | 0 | Organics | PPCPs | | | | | 2022-01-04 |
Gallium | Gallium | 7440553 | Inorganics | | | | | | 2013-05-20 |
Garbage Bag of Trash | Garbage Bag of Trash | 0 | Debris | Trash | Non-Plastics | Large | | | 2014-11-04 |
Gasoline | Gasoline | 0 | Organics | | | | | | 2010-08-10 |
Gemfibrozil | Gemfibrozil | 25812300 | Organics | PPCPs | | | | | 2012-05-22 |
Gemfibrozil-d6(IsoDilAnalogue) | Isotope Dilution Analogue: Gemfibrozil-d6 | 1184986455 | Organics | | | | | | 2022-07-22 |
Gemfibrozil-d6(Surrogate) | Surrogate: Gemfibrozil-d6 | 25812300 | Organics | PPCPs | | | | | 2016-03-02 |
Germination | Germination (%) | 0 | Toxicity | | | | | | 2007-07-27 |
Giardia | Giardia | 0 | Microbiological | Pathogens | Conventionals | | | | 2013-05-28 |
Giardia Cysts Fluorescence Antibody | Giardia Cysts Fluorescence Antibody | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts Negative | Giardia Cysts Negative | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/Amorphous Structure | Giardia Cysts/Amorphous Structure | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/DAPI & DIC Positive | Giardia Cysts/DAPI & DIC Positive | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/Empty | Giardia Cysts/Empty | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/Flourescence Antibody | Giardia Cysts/Flourescence Antibody | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/Internal Structure | Giardia Cysts/Internal Structure | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/Internal Structure (>One) | Giardia Cysts/Internal Structure (>One) | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/Internal Structure (One) | Giardia Cysts/Internal Structure (One) | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/Internal Structures (>One) | Giardia Cysts/Internal Structures (>One) | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/Negative | Giardia Cysts/Negative | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/Positive | Giardia Cysts/Positive | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/Positive (Internal Staining) | Giardia Cysts/Positive (Internal Staining) | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/Positive (Stained Nuclei) | Giardia Cysts/Positive (Stained Nuclei) | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Giardia Cysts/Total IFA Count | Giardia Cysts/Total IFA Count | 0 | Microbiological | Pathogens | | | | | 2017-03-27 |
Glass | Glass using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Glass Foam | Glass Foam | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Glass fragment | Glass fragment | 0 | Microdebris | Anthropogenic | Glass | Fragment | | | 2018-04-26 |
Glass Servicewear | Glass Servicewear | 0 | Debris | Trash | Non-Plastics | Household | | | 2014-11-04 |
Glass Shard | Glass Shard | 0 | Debris | Trash | Non-Plastics | Household | | | 2014-11-04 |
Glass sphere | Glass sphere | 0 | Microdebris | Anthropogenic | Glass | Sphere | | | 2018-04-26 |
Glide | Glide | 0 | Habitat | | | | | | 2009-08-20 |
Glide/Pool Bank Stability | Glide/Pool Bank Stability (used for EMAP RBP 20-score habitat characterization) | 0 | Habitat | | | | | | 2009-08-20 |
Glide/Pool Channel Alteration | Glide/Pool Channel Alteration | 0 | Habitat | | | | | | 2009-08-20 |
Glide/Pool Channel Flow Status | Glide/Pool Channel Flow Status | 0 | Habitat | | | | | | 2009-08-20 |
Glide/Pool Channel Sinuosity | Glide/Pool Channel Sinuosity | 0 | Habitat | | | | | | 2009-08-20 |
Glide/Pool Epifaunal Substrate | Glide/Pool Epifaunal Substrate | 0 | Habitat | | | | | | 2009-08-20 |
Glide/Pool Pool Substrate | Glide/Pool Pool Substrate | 0 | Habitat | | | | | | 2009-08-20 |
Glide/Pool Pool Variability | Glide/Pool Pool Variability | 0 | Habitat | | | | | | 2009-08-20 |
Glide/Pool Riparian Zone Width | Glide/Pool Riparian Zone Width | 0 | Habitat | | | | | | 2009-08-20 |
Glide/Pool Sediment Deposition | Glide/Pool Sediment Deposition | 0 | Habitat | | | | | | 2009-08-20 |
Glide/Pool Vegetative Protection | Glide/Pool Vegetative Protection | 0 | Habitat | | | | | | 2009-08-20 |
Glipizide | Glipizide | 29094619 | Organics | PPCPs | | | | | 2010-04-26 |
Glipizide-d11(Surrogate) | Surrogate: Glipizide-d11 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Glufosinate | Glufosinate | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Glyburide | Glyburide | 10238218 | Organics | PPCPs | | | | | 2010-04-26 |
Glyburide-d3(Surrogate) | Surrogate: Glyburide-d3 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Glyphosate | Glyphosate | 1071836 | Organics | Pesticides | Herbicides | | | | 2007-07-27 |
Glyphosate, isopropylamine salt | Glyphosate, isopropylamine salt | 38641940 | Organics | Pesticides | | | | | 2017-04-20 |
Gold | Gold | 0 | Inorganics | Metals | | | | | 2014-01-29 |
Golf Course/Parks/Sports Fields Extent | Golf Course/Parks/Sports Fields Extent | 0 | Habitat | | | | | | 2019-05-07 |
Golf Course/Parks/Sports Fields Intensity | Golf Course/Parks/Sports Fields Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Golf Course/Parks/Sports Fields Proximity | Golf Course/Parks/Sports Fields Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Gonad Index CI Mean | Gonad Index CI Mean | 0 | Tissue | Condition | | | | | 2014-02-05 |
Gonad Index Standard Error | Gonad Index Standard Error | 0 | Tissue | Condition | | | | | 2014-02-05 |
Grading/Compaction Extent | Grading/Compaction Extent | 0 | Habitat | | | | | | 2019-05-07 |
Grading/Compaction Intensity | Grading/Compaction Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Grading/Compaction Proximity | Grading/Compaction Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Granule | Granule | 0 | Inorganics | Conventionals | GrainSize | | | | 2011-09-08 |
Granule + Pebble | Granule + Pebble | 0 | Inorganics | Conventionals | GrainSize | | | | 2011-09-08 |
Gravel | Gravel | 0 | Inorganics | Conventionals | GrainSize | | | | 2011-09-08 |
Grazing_Recent | Evidence of grazing activiy by cattle within the past year | 0 | Habitat | | | | | | 2012-09-13 |
Gross Alpha | Gross Alpha | 12587461 | Radiochemistry | | | | | | 2013-05-20 |
Gross Beta | Gross Beta | 12587472 | Radiochemistry | | | | | | 2013-05-20 |
Groundwater Extraction Extent | Groundwater Extraction Extent | 0 | Habitat | | | | | | 2019-05-07 |
Groundwater Extraction Intensity | Groundwater Extraction Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Groundwater Extraction Proximity | Groundwater Extraction Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Growth (ash-free dry wt/surv indiv) | Growth (ash-free dry weight/surviving individual) | 0 | Toxicity | Endpoint | | | | | 2014-02-05 |
Growth (Chlorophyll a fluorescence) | Growth (Chlorophyll a fluorescence) | 0 | Toxicity | | | | | | 2022-11-15 |
Growth (Chlorophyll a) | Growth (Chlorophyll a) | 0 | Toxicity | | | | | | 2017-12-15 |
Growth (gonad) | Growth (gonad) | 0 | Toxicity | | | | | | 2007-07-27 |
Growth (length head capsule) | Growth (length head capsule) | 0 | Toxicity | | | | | | 2007-07-27 |
Growth (length) | Growth (length) | 0 | Toxicity | | | | | | 2007-07-27 |
Growth (weight) | Growth (weight) | 0 | Tissue | Condition | | | | | 2014-02-05 |
Growth (wt/surv indiv) | Growth (weight/surviving individual) | 0 | Toxicity | | | | | | 2007-07-27 |
Growth Ratio | Growth Ratio (final measurement / initial measurement) | 0 | Toxicity | | | | | | 2011-12-22 |
Growth Standard Error | Growth Standard Error | 0 | Tissue | Condition | | | | | 2014-02-05 |
H_AqHab | Shannon diversity of natural instream cover types physical-habitat metric | 0 | Bioassessment | | | | | | 2021-01-28 |
H_SubNat | Shannon diversity of natural substrate types physical-habitat metric | 0 | Bioassessment | | | | | | 2021-01-28 |
HabitatType | HabitatType | 0 | FieldObservations | Habitat | | | | | 2009-08-20 |
Halauxifen-methyl | Halauxifen-methyl | 943831989 | Organics | | | | | | 2022-10-28 |
Halofenozide | Halofenozide | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
Halosulfuron Methyl | Halosulfuron Methyl | 100784201 | Organics | Pesticides | Herbicides | | | | 2016-10-25 |
Hard Plastic Piece, non-specific | Hard Plastic Piece, non-specific | 0 | Debris | Trash | Plastics | Bags/Packaging | | | 2014-11-04 |
Hardened Features Other Extent | Hardened Features Other Extent | 0 | Habitat | | | | | | 2019-05-07 |
Hardened Features Other Intensity | Hardened Features Other Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Hardened Features Other Proximity | Hardened Features Other Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Hardness as CaCO3 | Hardness as CaCO3 | 0 | Inorganics | Conventionals | WaterQualityMeasurements | | | | 2007-07-27 |
Hatchability | Hatchability (%) | 0 | Toxicity | | | | | | 2007-07-27 |
Hay Extent | Hay Extent | 0 | Habitat | | | | | | 2019-05-07 |
Hay Intensity | Hay Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Hay Proximity | Hay Proximity | 0 | Habitat | | | | | | 2019-05-07 |
HCH, alpha- | alpha-Hexachlorocyclohexane (HCH) (alpha-BHC) | 319846 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2013-05-28 |
HCH, alpha-(Surrogate) | Surrogate: alpha-Hexachlorocyclohexane (HCH) (alpha-BHC) | 0 | Organics | Pesticides | | | | | 2014-01-28 |
HCH, beta- | beta-Hexachlorocyclohexane (HCH) (beta-BHC) | 319857 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2013-05-28 |
HCH, beta-(Surrogate) | Surrogate: beta-Hexachlorocyclohexane (HCH) (beta-BHC) | 319857 | Organics | Pesticides | | | | | 2016-03-02 |
HCH, beta-13C6(IsoDilAnalogues) | Isotopic Dilution Analogue: beta-Hexachlorocyclohexane-13C6 (HCH) (beta-BHC) | 222966689 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
HCH, delta- | delta-Hexachlorocyclohexane (HCH) (delta-BHC) | 319868 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2013-05-28 |
HCH, delta-(Surrogate) | Surrogate: delta-Hexachlorocyclohexane (HCH) (delta-BHC) | 0 | Organics | Pesticides | | | | | 2013-05-27 |
HCH, gamma- | gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane) | 58899 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2013-05-28 |
HCH, gamma-(Surrogate) | Surrogate: gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane) | 0 | Organics | Pesticides | | | | | 2013-05-29 |
HCH, gamma-/PCB 015/17/18 | gamma-HCH/PCB 15/17/18 | 0 | Organics | Pesticides/PCBs | | | | | 2014-02-01 |
HCH, gamma-/PCB 015/18 | gamma-HCH/PCB 15/18 | 0 | Organics | Pesticides/PCBs | | | | | 2014-02-01 |
HCH, gamma-/PCB 015/19 | gamma-HCH/PCB 15/19 | 0 | Organics | Pesticides/PCBs | | | | | 2014-02-01 |
HCH, gamma-/PCB 015/20 | gamma-HCH/PCB 15/20 | 0 | Organics | Pesticides/PCBs | | | | | 2014-02-01 |
HCH, gamma-/PCB 015/21 | gamma-HCH/PCB 15/21 | 0 | Organics | Pesticides/PCBs | | | | | 2014-02-01 |
HCH, gamma-/PCB 015/22 | gamma-HCH/PCB 15/22 | 0 | Organics | Pesticides/PCBs | | | | | 2014-02-01 |
HCH, gamma-/PCB 015/23 | gamma-HCH/PCB 15/23 | 0 | Organics | Pesticides/PCBs | | | | | 2014-02-01 |
HCH, gamma-/PCB 015/24 | gamma-HCH/PCB 15/24 | 0 | Organics | Pesticides/PCBs | | | | | 2014-02-01 |
HCH, gamma-/PCB 015/25 | gamma-HCH/PCB 15/25 | 0 | Organics | Pesticides/PCBs | | | | | 2014-02-01 |
HCH, gamma-/PCB 015/26 | gamma-HCH/PCB 15/26 | 0 | Organics | Pesticides/PCBs | | | | | 2014-02-01 |
HCH, gamma-13C6(IsoDilAnalogue) | Isotopic Dilution Analogue: gamma-Hexachlorocyclohexane-13C6 (HCH) (gamma-BHC) (Lindane) | 104215852 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
HCH-d6, gamma-(IsoDilAnalogue) | Isotopic Dilution Analogue: HCH-d6, gamma- | 0 | | | | | | | 2022-07-06 |
HCH-d6, gamma-(Surrogate) | Surrogate: gamma-Hexachlorocyclohexane-d6 (HCH-d6) (gamma-BHC-d6) (Lindane-d6) | 0 | Organics | Pesticides | | | | | 2013-06-20 |
Heavy Urban Other Extent | Heavy Urban Other Extent | 0 | Habitat | | | | | | 2019-05-07 |
Heavy Urban Other Intensity | Heavy Urban Other Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Heavy Urban Other Proximity | Heavy Urban Other Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Helicobacter, Avian (GFD) | Avian Helicobacter, Assay name: GFD, 5'-TCGGCTGAGCACTCTAGGG-3', 5'-GCGTCTCTTTGTACATCCCA-3' | 0 | Microbiological | | | | | | 2023-01-27 |
Heneicosane, n- | n-Heneicosane | 629947 | Organics | Alkanes | | | | | 2013-05-01 |
Hentriacontane, n- | n-Hentriacontane | 630046 | Organics | Alkanes | | | | | 2013-05-01 |
Hepatitis A Virus | Hepatitis A Virus | 0 | Microbiological | Pathogens | | | | | 2020-10-29 |
Heptachlor | Heptachlor | 76448 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
Heptachlor Epoxide | Heptachlor Epoxide | 1024573 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2013-05-28 |
Heptachlor Epoxide(Surrogate) | Surrogate: Heptachlor Epoxide | 0 | Organics | Pesticides | | | | | 2008-11-17 |
Heptachlor Epoxide, cis- | cis-Heptachlor Epoxide | 0 | Organics | Pesticides | | | | | 2016-05-20 |
Heptachlor Epoxide, trans- | trans-Heptachlor Epoxide | 0 | Organics | Pesticides | | | | | 2016-05-20 |
Heptachlor Epoxide/Oxychlordane | Heptachlor Epoxide/Oxychlordane | 0 | Organics | Pesticides | | | | | 2014-02-01 |
Heptachlor Epoxide-13C10(IsoDilAnalogue) | Isotopic Dilution Analogue: Heptachlor Epoxide-13C10 | 0 | | | | | | | 2022-07-06 |
Heptachlor Epoxide-13C10(Surrogate) | Surrogate: Heptachlor Epoxide-13C10 | 0 | Organics | Pesticides | | | | | 2013-06-17 |
Heptachlor Epoxide-13C10, cis-(Surrogate) | Surrogate: cis-Heptachlor Epoxide-13C10 | 0 | Organics | Pesticides | | | | | 2016-05-20 |
Heptachlor(Surrogate) | Surrogate: Heptachlor | 0 | Organics | Pesticides | | | | | 2008-11-17 |
Heptachlor-13C10(IsoDilAnalogue) | Isotopic Dilution Analogue: Heptachlor-13C10 | 0 | | | | | | | 2022-07-06 |
Heptachlor-13C10(Surrogate) | Surrogate: Heptachlor-13C10 | 0 | Organics | Pesticides | | | | | 2013-06-17 |
Heptachlorobenzene | Heptachlorobenzene | 0 | Organics | Pesticides | | | | | 2014-01-28 |
Heptacosane, n- | n-Heptacosane | 593497 | Organics | Alkanes | | | | | 2013-05-01 |
Heptadecane, n- | n-Heptadecane | 629787 | Organics | Alkanes | | | | | 2013-05-01 |
Hexabromobenzene | Hexabromobenzene (HBBZ) | 87821 | Organics | FlameRetardants | | | | | 2010-01-04 |
Hexabromocyclododecane, alpha- | alpha-Hexabromocyclododecane (alpha-HBCDD) | 0 | Organics | FlameRetardants | | | | | 2011-05-11 |
Hexabromocyclododecane, alpha-(Surrogate) | Surrogate: alpha-Hexabromocyclododecane (HBCDD) | 0 | Organics | FlameRetardants | | | | | 2013-05-27 |
Hexabromocyclododecane, beta- | beta-Hexabromocyclododecane (beta-HBCDD) | 0 | Organics | FlameRetardants | | | | | 2011-05-11 |
Hexabromocyclododecane, gamma- | gamma-Hexabromocyclododecane (gamma-HBCDD) | 0 | Organics | FlameRetardants | | | | | 2011-05-11 |
Hexabromocyclododecane, Total | Total Hexabromocyclododecane (HBCDD) | 3194556 | Organics | FlameRetardants | | | | | 2011-05-11 |
Hexabromocyclododecane-13C12(Surrogate) | Surrogate: Hexabromocyclododecane-13C12 (HBCDD) | 0 | Organics | FlameRetardants | | | | | 2014-01-28 |
Hexachloro(phenyl)norbornene | Hexachloro(phenyl)norbornene (HCPN) | 0 | Organics | FlameRetardants | | | | | 2015-07-16 |
Hexachlorobenzene | Hexachlorobenzene | 118741 | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | | 2007-07-27 |
Hexachlorobenzene(Surrogate) | Surrogate: Hexachlorobenzene | 0 | Organics | Pesticides | | | | | 2008-11-17 |
Hexachlorobenzene-13C6(IsoDilAnalogue) | Isotopic Dilution Analogue: Hexachlorobenzene-13C6 | 0 | | | | | | | 2022-07-06 |
Hexachlorobenzene-13C6(Surrogate) | Surrogate: Hexachlorobenzene-13C6 | 0 | Organics | Pesticides | | | | | 2013-06-17 |
Hexachlorobutadiene | Hexachlorobutadiene | 87683 | Organics | VOCs | SVOCs | Fungicides | | | 2007-07-27 |
Hexachlorocyclopentadiene | Hexachlorocyclopentadiene (HCCPD) | 77474 | Organics | SVOCs | | | | | 2007-07-27 |
Hexachlorocyclopentadienyldibromocyclooctane | Hexachlorocyclopentadienyldibromocyclooctane (HCDBCO) | 51936551 | Organics | FlameRetardants | | | | | 2014-03-13 |
Hexachloroethane | Hexachloroethane | 67721 | Organics | SVOCs | | | | | 2007-07-27 |
Hexacosane, n- | n-Hexacosane | 0 | Organics | Alkanes | | | | | 2014-01-28 |
Hexadecane, n- | n-Hexadecane | 0 | Organics | Alkanes | | | | | 2014-01-28 |
Hexahydro-1,3,5-trinitro-1,3,5-triazine | Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) | 121824 | Organics | | | | | | 2019-12-18 |
Hexanone, 2- | 2-Hexanone | 591786 | Organics | VOCs | | | | | 2007-07-27 |
Hexazinone | Hexazinone | 51235042 | Organics | Pesticides | Pest-Triazines | Herbicides | | | 2007-07-27 |
High Concentration of Salts Extent | High Concentration of Salts Extent | 0 | Habitat | | | | | | 2019-05-07 |
High Concentration of Salts Intensity | High Concentration of Salts Intensity | 0 | Habitat | | | | | | 2019-05-07 |
High Concentration of Salts Proximity | High Concentration of Salts Proximity | 0 | Habitat | | | | | | 2019-05-07 |
High density polyethylene fragment | HDPE fragment, that can be grouped under plastic category | 0 | Microdebris | Anthropogenic | Plastics | Fragment | | | 2018-04-26 |
Highway >2 lanes Extent | Highway >2 lanes Extent | 0 | Habitat | | | | | | 2019-05-07 |
Highway >2 lanes Intensity | Highway >2 lanes Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Highway >2 lanes Proximity | Highway >2 lanes Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Hiking Trails | Hiking Trails | 0 | Habitat | | | | | | 2009-08-20 |
Holmium | Holmium | 7440600 | Inorganics | | | | | | 2013-05-20 |
Homeless Encampment, Distance from Transect | Homeless Encampment, Distance from Transect | 0 | Habitat | Debris | | | | | 2014-11-04 |
Homeless Encampment, Distance from Transect Downstream | Homeless Encampment, Distance from Transect Downstream | 0 | Habitat | Debris | | | | | 2014-11-04 |
Homeless Encampment, Distance from Transect Upstream | Homeless Encampment, Distance from Transect Upstream | 0 | Habitat | Debris | | | | | 2014-11-04 |
Homeless Encampment, Within Transect | Homeless Encampment, Within Transect | 0 | Habitat | Debris | | | | | 2014-11-04 |
Hopane, C29- | C29-Hopane | 0 | Organics | Hopanes | | | | | 2014-01-28 |
Hopane, C30- | C30-Hopane | 0 | Organics | Hopanes | | | | | 2014-01-28 |
Horses Extent | Horses Extent | 0 | Habitat | | | | | | 2019-05-07 |
Horses Intensity | Horses Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Horses Proximity | Horses Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Hose Piece | Hose Piece | 0 | Debris | Trash | Non-Plastics | Household | | | 2014-11-04 |
Household | Household | 0 | Debris | Trash | Plastics | | | | 2014-11-05 |
Household, Other | Household, Other | 0 | Debris | Trash | Plastics | Non-Plastics | | | 2014-11-04 |
HpCDD, 1,2,3,4,6,7,8- | 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD) | 35822469 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-05-28 |
HpCDD, 1,2,3,4,6,7,8-(Surrogate) | Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD) | 35822469 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-06-02 |
HpCDD-13C, 1,2,3,4,6,7,8-(Surrogate) | Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin-13C (HpCDD) | 0 | Organics | DioxinsDibenzofurans | | | | | 2013-07-02 |
HpCDF, 1,2,3,4,6,7,8- | 1,2,3,4,6,7,8-Heptachlorodibenzofuran (HpCDF) | 67562394 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-05-28 |
HpCDF, 1,2,3,4,6,7,8-(Surrogate) | Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran | 0 | Organics | DioxinsDibenzofurans | | | | | 2015-06-22 |
HpCDF, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Heptachlorodibenzofuran | 0 | Organics | DioxinsDibenzofurans | | | | | 2015-06-22 |
HpCDF, 1,2,3,4,7,8,9- | 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF) | 55673897 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-05-28 |
HpCDF, 1,2,3,4,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF) | 67562394 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-06-02 |
HpCDF-13C, 1,2,3,4,6,7,8-(Surrogate) | Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran-13C (HpCDF) | 0 | Organics | DioxinsDibenzofurans | | | | | 2013-07-02 |
HpCDF-13C, 1,2,3,4,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran-13C (HpDDF) | 0 | Organics | DioxinsDibenzofurans | | | | | 2013-07-02 |
Human Adenovirus | | 0 | | | | | | | 2018-02-13 |
Human Norovirus GI | | 0 | | | | | | | 2018-02-13 |
Human Norovirus GII | | 0 | | | | | | | 2018-02-13 |
Human Waste/Diaper | Human Waste/Diaper | 0 | Debris | Trash | Non-Plastics | Toxic | | | 2014-11-04 |
HumanHealth | HumanHealth using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
HxCDD, 1,2,3,4,7,8- | 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) | 39227286 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-05-28 |
HxCDD, 1,2,3,4,7,8-(Surrogate) | Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) | 39227286 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-06-02 |
HxCDD, 1,2,3,6,7,8- | 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) | 57653857 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-05-28 |
HxCDD, 1,2,3,6,7,8-(Surrogate) | Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) | 57653857 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-06-02 |
HxCDD, 1,2,3,7,8,9- | 1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin (HxCDD) | 19408743 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-05-28 |
HxCDD-13C, 1,2,3,4,7,8-(Surrogate) | Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin-13C (HxCDD) | 0 | Organics | DioxinsDibenzofurans | | | | | 2013-07-02 |
HxCDD-13C, 1,2,3,6,7,8-(Surrogate) | Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin-13C (HxCDD) | 0 | Organics | DioxinsDibenzofurans | | | | | 2013-07-02 |
HxCDF, 1,2,3,4,7,8- | 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF) | 70648269 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-05-28 |
HxCDF, 1,2,3,4,7,8-(Surrogate) | Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF) | 70648269 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-06-02 |
HxCDF, 1,2,3,6,7,8- | 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF) | 57117449 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-05-28 |
HxCDF, 1,2,3,6,7,8-(Surrogate) | Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF) | 57117449 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-06-02 |
HxCDF, 1,2,3,7,8,9- | 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF) | 72918219 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-05-28 |
HxCDF, 1,2,3,7,8,9-(Surrogate) | Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF) | 72918219 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-06-02 |
HxCDF, 2,3,4,6,7,8- | 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF) | 60851345 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-05-28 |
HXCDF, 2,3,4,6,7,8-(Surrogate) | Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF) | 60851345 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-06-02 |
HxCDF-13C, 1,2,3,4,7,8-(Surrogate) | Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran-13C (HxCDF) | 0 | Organics | DioxinsDibenzofurans | | | | | 2013-07-02 |
HxCDF-13C, 1,2,3,6,7,8-(Surrogate) | Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran-13C (HxCDF) | 0 | Organics | DioxinsDibenzofurans | | | | | 2013-07-02 |
HxCDF-13C, 1,2,3,7,8,9-(Surrogate) | Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran-13C (HxCDF) | 0 | Organics | DioxinsDibenzofurans | | | | | 2013-07-02 |
HxCDF-13C, 2,3,4,6,7,8-(Surrogate) | Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran-13C (HxCDF) | 0 | Organics | DioxinsDibenzofurans | | | | | 2013-07-02 |
Hydramethylnon | Hydramethylnon | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
Hydraulic Height | Height from bottom of stream to top of bankfull height or the summation of station water depth and bankfull height | 0 | Habitat | | | | | | 2013-05-17 |
Hydrochlorothiazide | Hydrochlorothiazide | 58935 | Organics | PPCPs | | | | | 2010-04-26 |
Hydrocodone | Hydrocodone | 125291 | Organics | PPCPs | | | | | 2010-04-26 |
Hydrocodone-d3(Surrogate) | Surrogate: Hydrocodone-d3 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Hydrocortisone | Hydrocortisone | 50237 | Organics | PPCPs | | | | | 2010-04-26 |
Hydrocortisone-d4(Surrogate) | Surrogate: Hydrocortisone-d4 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Hydrogen Sulfide | Hydrogen Sulfide | 0 | WaterQualityMeasurements | | | | | | 2007-07-27 |
Hydrolyzable Phosphorus + Orthophosphate as P | Hydrolyzable Phosphorus + Orthophosphate as P | 0 | Inorganics | Conventionals | | | | | 2013-05-20 |
Hydroperiod | Hydroperiod of the waterbody | 0 | Habitat | | | | | | 2012-09-13 |
Hydroxide | Hydroxide | 14280309 | Inorganics | Conventionals | | | | | 2012-09-13 |
Hydroxide Alkalinity as CaCO3 | Hydroxide Alkalinity as CaCO3 | 471341 | Inorganics | Conventionals | WaterQualityMeasurements | | | | 1900-01-01 |
Hydroxy-amitriptyline, 10- | 10-Hydroxy-amitriptyline | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Hydroxyatrazine, 2- | 2-Hydroxyatrazine | 2163680 | Organics | Pesticides | Pest-Triazines | | | | 2010-05-18 |
Hydroxycarbofuran, 3- | 3-Hydroxycarbofuran | 16655826 | Organics | Pesticides | Insecticides | Carbamates | | | 2014-01-28 |
Hydroxydicamba, 5- | 5-Hydroxydicamba | 7600502 | Organics | Pesticides | | | | | 2017-04-10 |
Hydroxy-ibuprofen, 2- | 2-Hydroxy-ibuprofen | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Hydroxy-Imidacloprid, 5- | 5-Hydroxy-Imidacloprid | 380912094 | Organics | Pesticides | | | | | 2018-08-07 |
Hydroxypropanal, 3- | 3-Hydroxypropanal | 2134294 | Organics | Pesticides | | | | | 2008-11-17 |
Ibuprofen | Ibuprofen | 15687271 | Organics | PPCPs | | | | | 2012-05-22 |
Ibuprofen-13C3(Surrogate) | Surrogate: Ibuprofen-13C3 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Ibuprofen-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Ibuprofen-d3 | 121662144 | Organics | | | | | | 2022-07-22 |
Imazalil | Imazalil | 35554440 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Imazamox | Imazamox | 114311329 | Organics | | | | | | 2020-06-26 |
Imazapyr | Imazapyr | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Imazaquin | Imazaquin | 81335377 | Organics | Herbicides | | | | | 2013-05-20 |
Imazethapyr | Imazethapyr | 81335775 | Organics | Herbicides | | | | | 2013-05-20 |
Imidacloprid | Imidacloprid | 138261413 | Organics | PPCPs | | | | | 2012-09-13 |
Imidacloprid guanidine | Imidacloprid guanidine | 0 | Organics | Pesticides | | | | | 2017-04-20 |
Imidacloprid guanidine olefin | Imidacloprid guanidine olefin | 0 | Organics | Pesticides | | | | | 2017-04-20 |
Imidacloprid olefin | Imidacloprid olefin | 115086549 | Organics | Pesticides | | | | | 2017-04-20 |
Imidacloprid urea | Imidacloprid urea | 120868668 | Organics | Pesticides | | | | | 2017-04-20 |
Imidacloprid-d4(Surrogate) | Surrogate: Imidacloprid-d4 | 0 | Organics | Pesticides | Insecticides | | | | 2018-01-31 |
Imidaclothiz | Imidaclothiz | 105843365 | Organics | Pesticides | | | | | 2018-08-07 |
Incised Height | Incised Height | 0 | Habitat | | | | | | 2009-08-20 |
Increment | Increment | 0 | Habitat | | | | | | 2009-08-20 |
Indaziflam | Indaziflam | 950782862 | Organics | Herbicides | | | | | 2019-08-05 |
Indeno(1,2,3-c,d)pyrene | Indeno(1,2,3-c,d)pyrene | 193395 | Organics | PAHs | SVOCs | HMW_PAH | | | 2007-07-27 |
Indeno(1,2,3-c,d)pyrene-d12(Surrogate) | Surrogate: Indeno(1,2,3-c,d)pyrene-d12 | 0 | Organics | PAHs | | | | | 2012-04-04 |
Indole | Indole | 120729 | Organics | | | | | | 2018-07-16 |
Indoxacarb | Indoxacarb | 173584446 | Organics | Pesticides | Ozadiazine | Insecticides | | | 2015-09-11 |
Industrial Extent | Industrial Extent | 0 | Habitat | | | | | | 2019-05-07 |
Industrial Intensity | Industrial Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Industrial Plants | Industrial Plants | 0 | Habitat | | | | | | 2009-08-20 |
Industrial Proximity | Industrial Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Industrial Water Quality Other Extent | Industrial Water Quality Other Extent | 0 | Habitat | | | | | | 2019-05-07 |
Industrial Water Quality Other Intensity | Industrial Water Quality Other Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Industrial Water Quality Other Proximity | Industrial Water Quality Other Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Inorganic natural material | Inorganic natural material, including rock and minerals | 0 | Microdebris | Natural | Natural | Natural | | | 2018-04-26 |
Inorganic Natural Material Fiber | Inorganic natural material Fiber | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Inorganic Natural Material Film | Inorganic natural material Film | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Inorganic Natural Material Foam | Inorganic natural material Foam | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Inorganic Natural Material Fragment | Inorganic natural material Fragment | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Inorganic Natural Material Sphere | Inorganic natural material Sphere | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Instream Plant Cover | Instream Plant Cover | 0 | Habitat | | | | | | 2011-11-01 |
IntertidalSubstrateCharacteristics_Mud | IntertidalSubstrateCharacteristics_Mud | 0 | Habitat | Debris | | | | | 2014-11-04 |
IntertidalSubstrateCharacteristics_Rocky | IntertidalSubstrateCharacteristics_Rocky | 0 | Habitat | Debris | | | | | 2014-11-04 |
IntertidalSubstrateCharacteristics_Sand | IntertidalSubstrateCharacteristics_Sand | 0 | Habitat | Debris | | | | | 2014-11-04 |
IntertidalSubstrateCharacteristics_Vegetated | IntertidalSubstrateCharacteristics_Vegetated | 0 | Habitat | Debris | | | | | 2014-11-04 |
Invasive Plants Extent | Invasive Plants Extent | 0 | Habitat | | | | | | 2019-05-07 |
Invasive Plants Intensity | Invasive Plants Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Invasive Plants Proximity | Invasive Plants Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Iodomethane | Iodomethane | 74884 | | | | | Organics | Pesticide | 2016-07-29 |
Iohexol | Iohexol | 66108950 | | | | | | | 2018-08-31 |
Iopromide | Iopromide | 73334073 | | | | | | | 2018-08-31 |
Ioxynil | Ioxynil | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Ipconazole | Ipconazole | 125225287 | Organics | Pesticides | Fungicides | | | | 2016-07-27 |
IPI | Score for the Index of Physical-habitat Integrity (IPI) | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_Ev_FlowHab_qa | Quality assurance metric for the evenness of flow habitat types physical-habitat metric, calculated as the percent of expected measurements present in the input data | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_Ev_FlowHab_score | Scored evenness of flow habitat types physical-habitat metric | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_H_AqHab_pred | Predicted Shannon diversity of natural instream cover types physical-habitat metric | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_H_AqHab_qa | Quality assurance metric for the Shannon diversity of natural instream cover types physical-habitat metric, calculated as the percent of expected measurements present in the input data | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_H_AqHab_score | Scored Shannon diversity of natural instream cover types physical-habitat metric | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_H_SubNat_qa | Quality assurance metric for the Shannon diversity of natural substrate types physical-habitat metric, calculated as the percent of expected measurements present in the input data | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_H_SubNat_score | Scored Shannon diversity of natural substrate types physical-habitat metric | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_IPI_qa | Quality assurance metric for the Index of Physical-habitat Integrity score, calculated as the minimum of other quality assurance metric values | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_PCT_SAFN_pred | Predicted percent sands and fines streambed substrate physical-habitat metric | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_PCT_SAFN_qa | Quality assurance metric for the percent sands and fines physical-habitat metric, calculated as the percent of expected measurements present in the input data | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_PCT_SAFN_score | Scored percent sands and fines streambed substrate physical-habitat metric | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_XCMG_pred | Predicted riparian cover as sum of three layers physical-habitat metric | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_XCMG_qa | Quality assurance metric for the riparian cover metric, calculated as the percent of expected measurements present in the input data | 0 | Bioassessment | | | | | | 2021-01-28 |
IPI_XCMG_score | Scored riparian cover as sum of three layers physical-habitat metric | 0 | Bioassessment | | | | | | 2021-01-28 |
Iprodione | Iprodione | 36734197 | Organics | Fungicides | | | | | 2016-05-20 |
IQ Test - Fluorescence (EC50) | IQ Test - Fluorescence (EC50) | 0 | Toxicity | | | | | | 2007-07-27 |
Iron | Iron | 7439896 | Inorganics | Conventionals | Metals | | | | 2007-07-27 |
Irrigation Equipment | Irrigation Equipment | 0 | Habitat | | | | | | 2009-08-20 |
Isoborneol | Isoborneol | 124765 | Organics | | | | | | 2018-07-16 |
Isobutylparaben | Isobutylparaben | 4247023 | | | | | | | 2021-05-07 |
Isodecyl Diphenyl Phosphate | Isodecyl Diphenyl Phosphate | 29761215 | Organics | FlameRetardants | PhosphateFlameRetardants | | | | 2017-09-19 |
Isodrin | Isodrin | 0 | Organics | Pesticides | | | | | 2008-11-07 |
Isodrin-13C12(Surrogate) | Surrogate: Isodrin-13C12 | 0 | Organics | Pesticides | | | | | 2013-06-17 |
Isofenphos | Isofenphos | 25311711 | Organics | Pesticides | | | | | 2016-10-25 |
Isofetamid | Isofetamid | 875915789 | Organics | | | | | | 2018-07-16 |
Isophorone | Isophorone | 78591 | Organics | SVOCs | | | | | 2007-07-27 |
Isopropalin | Isopropalin | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Isopropyl Alcohol | Isopropyl Alcohol (2-propanol) | 67630 | | | | | | | 2017-01-12 |
Isopropylbenzene | Isopropylbenzene (Cumene) | 98828 | Organics | VOCs | | | | | 2013-05-28 |
Isopropylphenyl Diphenyl Phosphate | Isopropylphenyl Diphenyl Phosphate | 28108998 | Organics | FlameRetardants | PhosphateFlameRetardants | | | | 2017-09-19 |
Isopropyltoluene, p- | p-Isopropyltoluene | 99876 | Organics | VOCs | | | | | 2007-07-27 |
Isoproturon | Isoproturon | 34123596 | | | | | | | 2021-05-07 |
Isoquinoline | Isoquinoline | 119653 | Organics | | | | | | 2018-07-16 |
Isotopes | Isotopes | 0 | Inorganics | Conventionals | | | | | 2012-09-13 |
Isoxaben | Isoxaben (Flexidor) (Gallery) | 82558507 | Organics | Pesticides | | | | | 2016-05-20 |
Isoxaben(Surrogate) | Surrogate: Isoxaben (Flexidor) (Gallery) | 82558507 | Organics | Herbicides | | | | | 2013-05-28 |
ITEQ | International Toxic Equivalent (ITEQ) | 0 | Organics | DioxinsDibenzofurans | | | | | 2010-07-15 |
Jasmolin-1 | Jasmolin-1 (Jasmolin I) | 4466142 | Organics | Pesticides | Pyrethroids | | | | 2013-05-27 |
Jasmolin-2 | Jasmolin-2 (Jasmolin II) | 1172630 | Organics | Pesticides | Pyrethroids | | | | 2013-05-27 |
Kelp holdfast | Kelp holdfast | 0 | Debris | Natural | Non-Plastics | Marine Origin | | | 2014-11-04 |
Kelp Stipe/Blade | Kelp Stipe/Blade | 0 | Debris | Natural | Non-Plastics | Marine Origin | | | 2014-11-04 |
Kepone | Kepone (Chlordecone) | 143500 | Organics | Pesticides | Pest-OCHs | | | | 2013-05-28 |
Ketocarbofuran phenol, 3- | 3-ketocarbofuran phenol | 17781167 | Organics | Pesticides | | | | | 2017-04-10 |
Ketocarbofuran, 3- | 3-Ketocarbofuran | 16709301 | Organics | Pesticides | Pest-Carbamates | | | | 2013-05-20 |
Ketoprofen | Ketoprofen | 22071154 | | | | | | | 2021-05-07 |
Ketorolac | Ketorolac | 74103063 | | | | | | | 2021-05-07 |
Keyboard | Keyboard | 0 | Debris | Trash | Plastics | Toxic | | | 2014-11-04 |
Kresoxim-methyl | Kresoxim-methyl | 143390890 | Organics | Fungicides | | | | | 2016-05-20 |
Lachnospiraceae, Canine (DG37) | Canine Lachnospiraceae, Assay name: DG37, 5'-TTTTCTCCCACGGTCATCTG-3', 5'-CTTGGTTATGGGCGACATTG-3' | 0 | Microbiological | | | | | | 2023-01-27 |
Landfill Extent | Landfill Extent | 0 | Habitat | | | | | | 2019-05-07 |
Landfill Intensity | Landfill Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Landfill Proximity | Landfill Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Lanthanum | Lanthanum | 7439910 | Inorganics | | | | | | 2013-05-20 |
Large | Large using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Large/Unmovable, Other | Large/Unmovable, Other | 0 | Debris | Trash | Non-Plastics | Large | | | 2014-11-04 |
Larval abnormality | Larval abnormality | 0 | Toxicity | | | | | | 2007-07-27 |
Lead | Lead | 7439921 | Inorganics | TraceElements | Metals | | | | 2007-07-27 |
Length | Length | 0 | Tissue | Habitat | WaterQualityMeasurements | Conventionals | CollectionDevice | | 2012-06-01 |
Length Downstream | Length Downstream from X location | 0 | Habitat | | | | | | 2013-05-28 |
Length Pool | Length Pool | 0 | Habitat | | | | | | 2012-05-22 |
Length Reach | Length Reach | 0 | Habitat | | | | | | 2013-05-28 |
Length Riffle | Length Riffle | 0 | Habitat | | | | | | 2012-05-22 |
Length Root | Length Root | 0 | Toxicity | | | | | | 2013-05-28 |
Length Shoot | Length Shoot | 0 | Toxicity | | | | | | 2013-05-28 |
Length Upstream | Length Upstream from X location | 0 | Habitat | | | | | | 2013-05-28 |
Length, Segment | Segment Length | 0 | Habitat | | | | | | 2009-08-20 |
Leptophos | Leptophos | 21609905 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Level Of Trash | Level Of Trash using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Lid | Lid | 0 | Debris | Trash | Plastics | FoodService | | | 2014-11-04 |
Lidocaine | Lidocaine | 137586 | | | | | | | 2021-05-07 |
Light Urban Other Extent | Light Urban Other Extent | 0 | Habitat | | | | | | 2019-05-07 |
Light Urban Other Intensity | Light Urban Other Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Light Urban Other Proximity | Light Urban Other Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Lighter | Lighter | 0 | Debris | Trash | Plastics | Toxic | | | 2014-11-04 |
Liming | Liming | 0 | Habitat | | | | | | 2009-08-20 |
Limonene, d- | d-Limonene | 0 | Organics | | | | | | 2018-07-16 |
Lincomycin | Lincomycin | 154212 | Organics | PPCPs | | | | | 2012-05-22 |
Linuron | Linuron | 330552 | Organics | Pesticides | Herbicides | | | | 2007-07-27 |
Linuron-d6(Surrogate) | Surrogate: Linuron-d6 | 1219804768 | Organics | Pesticides | Herbicides | | | | 2021-10-19 |
Lipid | Lipid | 0 | Organics | Inorganics | Conventionals | | | | 2007-07-27 |
Lithium | Lithium | 7439932 | Inorganics | Metals | | | | | 2009-08-05 |
Littering | Littering using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Live young | Live young (#) | 0 | Toxicity | | | | | | 2007-07-27 |
Livestock Use | Livestock Use | 0 | Habitat | | | | | | 2009-08-20 |
Logging | Logging | 0 | Habitat | | | | | | 2009-08-20 |
Lomefloxacin | Lomefloxacin | 98079517 | Organics | PPCPs | | | | | 2010-04-26 |
Loss On Ignition | Loss On Ignition (LOI) | 0 | Inorganics | Conventionals | | | | | 2009-04-21 |
Low density polyethylene fragment | LDPE fragment, that can be grouped under plastic category | 0 | Microdebris | Anthropogenic | Plastics | Fragment | | | 2018-04-26 |
LWD >0.8 DLE, Length >15m | LWD >0.8 DLE, Length >15m | 0 | Habitat | | | | | | 2009-08-20 |
LWD >0.8m DLE, Length 1.5-5m | LWD >0.8m DLE, Length 1.5-5m | 0 | Habitat | | | | | | 2009-08-20 |
LWD >0.8m DLE, Length 5-15m | LWD >0.8m DLE, Length 5-15m | 0 | Habitat | | | | | | 2009-08-20 |
LWD 0.1-<0.3m DLE, Length >15m | LWD 0.1-<0.3m DLE, Length >15m | 0 | Habitat | | | | | | 2009-08-20 |
LWD 0.1-<0.3m DLE, Length 1.5-5m | LWD 0.1-<0.3m DLE, Length 1.5-5m | 0 | Habitat | | | | | | 2009-08-20 |
LWD 0.1-<0.3m DLE, Length 5-15m | LWD 0.1-<0.3m DLE, Length 5-15m | 0 | Habitat | | | | | | 2009-08-20 |
LWD 0.3-<0.6m DLE, Length >15 | LWD 0.3-<0.6m DLE, Length >15 | 0 | Habitat | | | | | | 2009-08-20 |
LWD 0.3-<0.6m DLE, Length 1.5-5m | LWD 0.3-<0.6m DLE, Length 1.5-5m | 0 | Habitat | | | | | | 2009-08-20 |
LWD 0.3-<0.6m DLE, Length 5-15m | LWD 0.3-<0.6m DLE, Length 5-15m | 0 | Habitat | | | | | | 2009-08-20 |
LWD 0.6-<0.8m DLE, Length >15m | LWD 0.6-<0.8m DLE, Length >15m | 0 | Habitat | | | | | | 2009-08-20 |
LWD 0.6-<0.8m DLE, Length 1.5-5m | LWD 0.6-<0.8m DLE, Length 1.5-5m | 0 | Habitat | | | | | | 2009-08-20 |
LWD 0.6-<0.8m DLE, Length 5-15 | LWD 0.6-<0.8m DLE, Length 5-15 | 0 | Habitat | | | | | | 2009-08-20 |
LWD A | Large Woody Debris in the A class of corresponding Diameter and Length categories | 0 | Habitat | | | | | | 2012-05-22 |
LWD L | Large Woody Debris in the L class of corresponding Diameter and Length categories | 0 | Habitat | | | | | | 2012-05-22 |
LWD M | Large Woody Debris in the M class of corresponding Diameter and Length categories | 0 | Habitat | | | | | | 2012-05-22 |
LWD S | Large Woody Debris in the S class of corresponding Diameter and Length categories | 0 | Habitat | | | | | | 2012-05-22 |
LWD T | Large Woody Debris in the T class of corresponding Diameter and Length categories | 0 | Habitat | | | | | | 2012-05-22 |
Lyngbyatoxin-a | Lyngbyatoxin-a | 0 | Microbiological | Cyanotoxins | | | | | 2012-05-22 |
Macroalgae Cover, Attached | Presence/Absence of attached macroalgae at a point along a transect | 0 | Habitat | | | | | | 2008-12-04 |
Macroalgae Cover, Unattached | Presence/Absence of unattached macroalgae at a point along a transect | 0 | Habitat | | | | | | 2008-12-04 |
Macroinvertebrate Habitat Patch Richness Metric | Metric assesses macroinvertebrate habitat patch richness along the channel edge and bank within the assessment area. | 0 | Habitat | | | | | | 2019-05-13 |
Macrophyte Cover | Presence/Absence of macrophytes at a point along a transect | 0 | Habitat | | | | | | 2008-12-04 |
Magnesium | Magnesium | 7439954 | Inorganics | Conventionals | Metals | AlkalineEarthMetals | Constituents | | 2007-07-27 |
Maintained Lawns | Maintained Lawns | 0 | Habitat | | | | | | 2009-08-20 |
Malachite Green | Malachite Green | 569642 | Organics | | | | | | 2017-07-26 |
Malaoxon | Malaoxon | 1634782 | Organics | Pesticides | | | | | 2016-03-10 |
Malathion | Malathion | 121755 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Maleic hydrazide | Maleic hydrazide | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Male-specific F+ Coliphage (E. coli Famp) | Male-specific F+ coliphages, Host Bacterium Strain: E. coli Famp | 0 | | | | | | | 2022-02-11 |
Mancozeb | Mancozeb | 0 | Organics | Pesticides | Fungicides | | | | 2017-04-04 |
Mandestrobin | Mandestrobin | 173662970 | Organics | | | | | | 2022-10-28 |
Mandipropamid | Mandipropamid | 374726622 | Organics | Pesticides | Fungicides | | | | 2016-09-06 |
Maneb | Maneb | 0 | Organics | Pesticides | Fungicides | | | | 2017-04-04 |
Manganese | Manganese | 7439965 | Inorganics | TraceElements | Metals | Conventionals | | | 2007-07-27 |
Marbon CNB 23010-1 | Marbon CNB 23010 (VCH-DP isomer 1) | 26595573 | Organics | FlameRetardants | | | | | 2015-07-16 |
Marbon CNB 23010-2 | Marbon CNB 23010 (VCH-DP isomer 2) | 26595573 | Organics | FlameRetardants | | | | | 2015-07-16 |
Marine, Other | Marine, Other | 0 | Debris | Natural | Non-Plastics | Marine Origin | | | 2014-11-04 |
Mature | Mature (%) | 0 | Toxicity | | | | | | 2007-07-27 |
Mature females | Mature females (%) | 0 | Toxicity | | | | | | 2007-07-27 |
MBAS | MBAS (Methylene Blue Active Substances) | 0 | Inorganics | Surfactants | | | | | 2013-05-28 |
MCPA | MCPA (2-Methyl-4-chlorophenoxy)Acetic Acid) (2,4-MCPA) | 94746 | Organics | Herbicides | | | | | 2013-05-28 |
MCPA, alkanolamine salt | MCPA, alkanolamine salt | 0 | Organics | Pesticides | | | | | 2017-04-20 |
MCPA, butoxyethanol ester | MCPA, butoxyethanol ester | 19480434 | Organics | Pesticides | | | | | 2017-04-20 |
MCPA, dimethylamine salt | MCPA, dimethylamine salt | 2039465 | Organics | Pesticides | | | | | 2017-04-20 |
MCPA, isooctyl ester | MCPA, isooctyl ester | 26544207 | Organics | Pesticides | | | | | 2017-04-20 |
MCPA, sodium salt | MCPA, sodium salt | 3653483 | Organics | Pesticides | | | | | 2017-04-20 |
MCPP | MCPP (2-(2-Methyl-4-chlorophenoxy) Propionic Acid) | 93652 | Organics | Herbicides | | | | | 2013-05-28 |
MCPP, diethanolamine salt | MCPP, diethanolamine salt | 1432140 | Organics | Pesticides | | | | | 2017-04-20 |
MCPP, dimethylamine salt | MCPP, dimethylamine salt | 32351705 | Organics | Pesticides | | | | | 2017-04-20 |
MCPP, potassium salt | MCPP, potassium salt | 1929868 | Organics | Pesticides | | | | | 2017-04-20 |
Mean Grain Size | Mean Grain Size | 0 | Inorganics | Conventionals | | | | | 2016-07-18 |
Mean Growth (Ash Free Dry Weight) | Mean Growth (Ash Free Dry Weight) | 0 | Toxicity | Endpoint | | | | | 2014-02-05 |
Mean Percent Normal Alive | The observed number of normal larvae divided by the mean number of live embryos inoculated at the beginning of the test | 0 | Toxicity | Endpoint | | | | | 2014-02-05 |
Mechanical Pencil | Mechanical Pencil | 0 | Debris | Trash | Plastics | Household | | | 2014-11-04 |
Meclofenamic Acid | Meclofenamic Acid | 644622 | | | | | | | 2021-05-07 |
Median Effective Concentration | Median Effective Concentration | 0 | Toxicity | | | | | | 2013-05-28 |
Median Grain Size | Median Grain Size | 0 | Inorganics | Conventionals | | | | | 2016-07-11 |
Median Inhibatory Concentration | Median Inhibatory Concentration | 0 | Toxicity | | | | | | 2013-05-28 |
Medical Device | Medical Device | 0 | Debris | Trash | Plastics | Toxic | | | 2014-11-04 |
Menthol | Menthol | 0 | Organics | | | | | | 2018-07-16 |
Meprobamate | Meprobamate | 57534 | Organics | PPCPs | | | | | 2010-04-26 |
Mercuric Chloride | Mercuric Chloride | 0 | Inorganics | Metals | | | | | 2017-04-04 |
Mercury | Mercury | 7439976 | Inorganics | TraceElements | Metals | | | | 2007-07-27 |
Mercury (II)R | Reactive Mercury | 0 | Inorganics | Metals | | | | | 2014-01-29 |
Mercury, Acid Labile | Acid Labile Mercury | 0 | Inorganics | Metals | | | | | 2014-01-29 |
Mercury, Extract Fraction 1 | Mercury selective sequential extraction, Fraction 1 | 0 | Inorganics | | | | | | 2020-10-27 |
Mercury, Extract Fraction 2 | Mercury selective sequential extraction, Fraction 2 | 0 | Inorganics | | | | | | 2020-10-27 |
Mercury, Extract Fraction 3 | Mercury selective sequential extraction, Fraction 3 | 0 | Inorganics | | | | | | 2020-10-27 |
Mercury, Extract Fraction 4 | Mercury selective sequential extraction, Fraction 4 | 0 | Inorganics | | | | | | 2020-10-27 |
Mercury, Extract Fraction 5 | Mercury selective sequential extraction, Fraction 5 | 0 | Inorganics | | | | | | 2020-10-27 |
Mercury, Methyl | Methyl Mercury | 22967926 | Inorganics | TraceElements | Metals | | | | 2007-07-27 |
Merphos | Merphos (Tributylphosphorotrithioite) | 150505 | Organics | Pesticides | Pest-OPs | | | | 2007-07-27 |
Mesh Size | Mesh Size | 0 | Tissue | Habitat | | | | | 2009-08-20 |
Metabolite B | Metabolite B (metabolite of Benzobicyclon) | 0 | | | | | | | 2017-12-12 |
Metal | Metal using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Metal Object | Metal Object | 0 | Debris | Trash | Non-Plastics | Metals | | | 2014-11-04 |
Metal Pipe/Bar | Metal Pipe/Bar | 0 | Debris | Trash | Non-Plastics | Metals | | | 2014-11-04 |
Metal, Other | Metal, Other | 0 | Debris | Trash | Non-Plastics | Metals | | | 2014-11-04 |
Metalaxyl | Metalaxyl | 57837191 | Organics | Herbicides | | | | | 2013-05-20 |
Metalaxyl-hydroxymethyl | Metalaxyl-hydroxymethyl | 85933499 | Organics | | | | | | 2022-11-03 |
Metaldehyde | Metaldehyde | 0 | Organics | Pesticides | | | | | 2017-04-04 |
Metam-Sodium | Metam-Sodium | 0 | Organics | Pesticides | | | | | 2017-04-04 |
Metazachlor | Metazachlor | 67129082 | | | | | | | 2021-05-07 |
Metconazole | Metconazole | 125116236 | Organics | Fungicides | | | | | 2016-05-20 |
MeterAveragingInterval | Time period (seconds) upon which the meter reading is averaged internally to attain a result | 0 | WaterQualityMeasurements | | | | | | 2012-05-22 |
Metformin | Metformin | 657249 | Organics | PPCPs | | | | | 2010-04-26 |
Metformin-d6(Surrogate) | Surrogate: Metformin-d6 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Methadone | Methadone | 76993 | | | | | | | 2018-08-20 |
Methamidophos | Methamidophos (O,S-Dimethyl thiophosphate) | 10265926 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2013-05-28 |
Methidathion | Methidathion | 950378 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Methidathion oxon | Methidathion oxon | 0 | Organics | Pesticides | | | | | 2017-04-20 |
Methiocarb | Methiocarb | 2032657 | Organics | Pesticides | Pest-Carbamates | Insecticides | | | 2007-07-27 |
Methiocarb sulfone | Methiocarb sulfone | 2179251 | Organics | Pesticides | | | | | 2017-04-20 |
Methiocarb sulfoxide | Methiocarb sulfoxide | 2635101 | Organics | Pesticides | | | | | 2017-04-20 |
Methomyl | Methomyl | 16752775 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Methoprene | Methoprene | 40596698 | Organics | Pesticides | | | | | 2008-11-17 |
Methoxychlor | Methoxychlor | 72435 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
Methoxychlor(Surrogate) | Surrogate: Methoxychlor | 0 | Organics | Pesticides | OrganochlorinePesticides | Semi-VOAs | | | 2011-07-15 |
Methoxychlor-d6(Surrogate) | Surrogate: Methoxychlor-d6 | 0 | Organics | Pesticides | | | | | 2013-06-17 |
Methoxyfenozide | Methoxyfenozide | 161050584 | Organics | Pesticides | Insecticides | | | | 2016-03-10 |
Methoxy-methylsulfanylphosphoryl acetamide, N- | N-Methoxy-methylsulfanylphosphoryl acetamide (Acephate) | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
Methyl (3,4-dichlorophenyl)carbamate | Methyl (3,4-dichlorophenyl)carbamate (Swep) | 1918189 | Organics | Pesticides | Pest-Carbamates | | | | 2013-05-28 |
Methyl 2,4-dichlorophenylacetate | Methyl 2,4-dichlorophenylacetate (2,4-DCAA) | 55954239 | | | | | | | 2017-01-12 |
Methyl 3-Amino-2,5-dichlorobenzoate | Methyl 3-Amino-2,5-dichlorobenzoate (Chloramben Methyl) | 7286840 | Organics | Herbicides | | | | | 2013-05-20 |
Methyl isothiocyanate | Methyl isothiocyanate | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Methyl paraoxon | Methyl paraoxon | 950356 | Organics | Pesticides | | | | | 2017-04-20 |
Methyl Perfluorooctane Sulfonamido Acetic Acid, N- | N-Methyl Perfluorooctane Sulfonamido Acetic Acid (Me-PFOSA-AcOH) | 0 | Organics | PFAS | PFC Precursor | | | | 2014-10-20 |
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3 (N-MeFOSAA) | 0 | Organics | | | | | | 2022-02-24 |
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(Surrogate) | Surrogate: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3 | 0 | Organics | PFAS | PFC Precursor | | | | 2014-11-03 |
Methyl salicylate | Methyl salicylate | 119368 | Organics | | | | | | 2018-07-16 |
Methyl Tert-butyl Ether | Methyl Tert-butyl Ether (MTBE) | 1634044 | Organics | VOCs | MTBE_BTEX | | | | 2013-05-28 |
Methyl triclosan | Methyl triclosan | 4640011 | Organics | PPCPs | | | | | 2018-07-24 |
Methyl Triclosan-13C12(Surrogate) | Surrogate: Methyl Triclosan-13C12 | 0 | Organics | PPCPs | | | | | 2018-08-07 |
Methyl vinyl ether Co-polymers Fiber | Methyl vinyl ether copolymers Fiber | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Methyl vinyl ether Co-polymers Film | Methyl vinyl ether copolymers Film | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Methyl vinyl ether Co-polymers Foam | Methyl vinyl ether copolymers Foam | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Methyl vinyl ether Co-polymers Fragment | Methyl vinyl ether copolymers Fragment | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Methyl-1(H)-indole, 3- | 3-Methyl-1(H)-indole (Skatole) | 83341 | Organics | | | | | | 2018-07-16 |
Methyl-1H-benzotriazole, 5- | 5-Methyl-1H-benzotriazole | 136856 | Organics | | | | | | 2018-07-16 |
Methyl-2-pentanone, 4- | 4-Methyl-2-pentanone (Methyl Isobutyl Ketone) | 108101 | Organics | VOCs | | | | | 2013-05-28 |
Methylanthracene | Methylanthracene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Methylanthracene, 2- | 2-Methylanthracene | 613127 | Organics | PAHs | Semi-VOAs | | | | 2010-07-08 |
Methylbenzo(a)pyrene, 7- | 7-Methylbenzo(a)pyrene | 63041770 | Organics | PAHs | | | | | 2013-08-27 |
Methylchlolanthrene, 3- | Methylchlolanthrene, 3- | 0 | Organics | PAHs | | | | | 2016-05-20 |
Methylchrysene, 1- | 1-Methylchrysene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Methylchrysene, 5/6- | 5-Methylchrysene/6-Methylchrysene | 0 | Organics | PAHs | | | | | 2011-06-20 |
Methyldibenzothiophene, 2- | 2-Methyldibenzothiophene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Methyldibenzothiophene, 4- | 4-Methyldibenzothiophene | 7372885 | Organics | PAHs | SVOCs | | | | 2007-07-27 |
Methyldibenzothiophenes, 2/3- | 2-Methyldibenzothiophene/3-Methyldibenzothiophene | 0 | Organics | PAHs | | | | | 2010-09-23 |
Methylene Chloride | Methylene Chloride (Dichloromethane) | 75092 | Organics | VOCs | | | | | 2013-05-28 |
Methylenebis(2-chloroaniline), 4,4'- | 4,4'-Methylenebis(2-chloroaniline) | 0 | Organics | VOCs | | | | | 2014-01-29 |
Methylfluoranthene, 2- | 2-Methylfluoranthene | 33543316 | Organics | PAHs | SVOCs | HMW_PAH | | | 2007-07-27 |
Methylfluoranthene, 3- | 3-Methylfluoranthene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Methylfluoranthene, 3-/Benzo(a)fluorene | 3-Methylfluoranthene/Benzo(a)fluorene | 0 | Organics | PAHs | HMW_PAH | | | | 2018-07-24 |
Methylfluorene, 1- | 1-Methylfluorene | 1730376 | Organics | PAHs | SVOCs | | | | 2007-07-27 |
Methylfluorene, 2- | 2-Methylfluorene | 1430973 | Organics | PAHs | Semi-VOAs | | | | 2010-07-08 |
Methylnaphthalene, 1- | 1-Methylnaphthalene | 90120 | Organics | PAHs | SVOCs | LMW_PAH | | | 2007-07-27 |
Methylnaphthalene, 2- | 2-Methylnaphthalene | 91576 | Organics | PAHs | SVOCs | LMW_PAH | | | 2007-07-27 |
Methylnaphthalene-d10, 2-(Surrogate) | Surrogate: 2-Methylnaphthalene-d10 | 0 | Organics | PAHs | | | | | 2012-04-04 |
Methylparaben | Methylparaben | 99763 | | | | | | | 2021-05-07 |
Methyl-perfluorooctanesulfonamide, N- | N-Methyl-perfluorooctanesulfonamide | 0 | Organics | PFAS | | | | | 2010-02-23 |
Methyl-perfluorooctanesulfonamide-d3, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Methyl-perfluorooctanesulfonamide-d3 (N-MeFOSA) | 0 | Organics | | | | | | 2022-03-04 |
Methyl-perfluorooctanesulfonamide-d3, N-(Surrogate) | Surrogate: Methyl-perfluorooctanesulfonamide-d3, N- (N-MeFOSA) | 0 | Organics | PFAS | | | | | 2021-06-02 |
Methyl-perfluorooctanesulfonamidoethanol, N- | N-Methyl-perfluorooctanesulfonamidoethanol | 0 | Organics | PFAS | | | | | 2010-02-23 |
Methyl-perfluorooctanesulfonamidoethanol-d7, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Methyl-perfluorooctanesulfonamidoethanol-d7 (N-MeFOSE) | 0 | Organics | | | | | | 2022-02-24 |
Methyl-perfluorooctanesulfonamidoethanol-d7, N-(Surrogate) | Surrogate: N-Methyl-perfluorooctanesulfonamidoethanol-d7 | 0 | Organics | PFAS | | | | | 2010-02-23 |
Methylphenanthrene | Methylphenanthrene | 0 | Organics | | | | | | 2017-05-04 |
Methylphenanthrene, 1- | 1-Methylphenanthrene | 832699 | Organics | PAHs | SVOCs | LMW_PAH | | | 2007-07-27 |
Methylphenanthrene, 2- | 2-Methylphenanthrene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Methylphenanthrene, 3- | 3-Methylphenanthrene | 832713 | Organics | PAHs | SVOCs | LMW_PAH | | | 2014-12-08 |
Methylphenanthrene, 3/4- | 3/4-Methylphenanthrene | 0 | Organics | PAHs | | | | | 2014-12-23 |
Methylphenanthrene, 9/4- | 9/4-Methylphenanthrene | 0 | Organics | PAHs | SVOCs | LMW_PAH | | | 2014-12-08 |
Methylphenanthrene-d10, 2-(Surrogate) | Surrogate: 2-Methylphenanthrene-d10 | 0 | Organics | PAHs | | | | | 2012-04-04 |
Methylphenol, 2- | 2-Methylphenol | 95487 | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | | 2007-07-27 |
Methylphenol, 2-(Surrogate) | Surrogate: 2-Methylphenol | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Methylphenol, 3- | 3-Methylphenol | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Methylphenol, 3/4- | 3-Methylphenol/4-Methylphenol | 106445 | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | | 2007-07-27 |
Methylphenol, 3/4-(Surrogate) | Surrogate: 3-Methylphenol/4-Methylphenol | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Methylphenol, 4- | 4-Methylphenol | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Methylprednisolone | Methylprednisolone | 83432 | Organics | PPCPs | | | | | 2010-04-26 |
Methylprednisolone-d2(Surrogate) | Surrogate: Methylprednisolone-d2 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Methylprednisolone-d3(Surrogate) | Surrogate: Methylprednisolone-d3 | 0 | Organics | PPCPs | | | | | 2018-01-29 |
Methylpyridine, 2- | 2-Methylpyridine | 0 | Organics | VOCs | | | | | 2014-02-05 |
Metiram | Metiram | 0 | Organics | Pesticides | Fungicides | | | | 2017-04-04 |
Metolachlor | Metolachlor | 51218452 | Organics | Herbicides | | | | | 2007-07-27 |
Metolachlor ethanesulfonic acid | Metolachlor ethanesulfonic acid | 171118095 | Organics | Pesticides | | | | | 2017-04-20 |
Metolachlor oxanilic acid | Metolachlor oxanilic acid | 0 | Organics | Pesticides | | | | | 2017-04-20 |
Metolachlor, S- | S-Metolachlor | 87392129 | Organics | Pesticides | | | | | 2019-06-13 |
Metolachlor-13C6(Surrogate) | Surrogate: Metolachlor-13C6 | 0 | Organics | | | | | | 2022-10-27 |
Metoprolol | Metoprolol | 51384511 | Organics | PPCPs | | | | | 2010-04-26 |
Metoprolol-d7(Surrogate) | Surrogate: Metoprolol-d7 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Metribuzin | Metribuzin | 21087649 | Organics | Herbicides | | | | | 2007-07-27 |
Metsulfuron Methyl | Metsulfuron Methyl | 74223646 | Organics | Herbicides | | | | | 2013-05-20 |
Mevinphos | Mevinphos (Phosdrin) | 7786347 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Mexacarbate | Mexacarbate | 315184 | Organics | Pesticides | Pest-Carbamates | Insecticides | | | 2007-07-27 |
MGK 264 | MGK 264 (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide) | 0 | | | | | | | 2017-01-12 |
MGK 264-A | MGK 264 Peak A (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide) | 113484 | Organics | Pesticides | | | | | 2018-08-07 |
MGK 264-B | MGK 264 Peak B (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide) | 113484 | Organics | Pesticides | | | | | 2018-08-07 |
Miconazole | Miconazole | 22916478 | Organics | PPCPs | | | | | 2010-04-26 |
Microalgae Thickness | Thickness of microalgae (if present) at a point along a transect | 0 | Habitat | | | | | | 2008-12-04 |
Microcystin-[Dha7]LR | Microcystin-[dehydroalanine7]LR | 0 | | | | | | | 2019-03-21 |
Microcystin-[DLeu1]LR | Microcystin-[deleucine1]LR | 0 | | | | | | | 2019-03-21 |
Microcystin-HilR | Microcystin- homoisoleucineR | 0 | | | | | | | 2019-03-21 |
Microcystin-HtyR | Microcystin-homotyrosineR | 0 | | | | | | | 2019-03-21 |
Microcystin-LA | Microcystin-LA (MCY-LA) | 96180799 | Microbiological | Cyanotoxins | | | | | 2013-05-28 |
Microcystin-LF | Microcystin-LF (MCY-LF) | 154037704 | Microbiological | Cyanotoxins | | | | | 2013-05-28 |
Microcystin-LR | Microcystin-LR (MCY-LR) | 101043372 | Microbiological | Cyanotoxins | | | | | 2013-05-28 |
Microcystin-LW | Microcystin-LW (MCY-LW) | 157622021 | Microbiological | Cyanotoxins | | | | | 2013-05-28 |
Microcystin-LY | Microcystin-LY (MCY-LY) | 123304109 | Microbiological | Cyanotoxins | | | | | 2013-05-28 |
Microcystin-RR | Microcystin-RR (MCY-RR) | 111755374 | Microbiological | Cyanotoxins | | | | | 2013-05-28 |
Microcystins, Total | Total Microcystins | 0 | Microbiological | Cyanotoxins | | | | | 2014-03-07 |
Microcystin-WR | Microcystin-WR (MCY-WR) | 0 | | | | | | | 2019-03-21 |
Microcystin-YR | Microcystin-YR (MCY-YR) | 101064486 | Microbiological | Cyanotoxins | | | | | 2013-05-28 |
Military Land Extent | Military Land Extent | 0 | Habitat | | | | | | 2019-05-07 |
Military Land Intensity | Military Land Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Military Land Proximity | Military Land Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Milk Carton | Milk Carton | 0 | Debris | Trash | Plastics | FoodService | | | 2014-11-04 |
Mines, Quaries | Mines, Quaries | 0 | Habitat | | | | | | 2009-08-20 |
Mining Extent | Mining Extent | 0 | Habitat | | | | | | 2019-05-07 |
Mining Intensity | Mining Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Mining Proximity | Mining Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Mirex | Mirex | 2385855 | Organics | Pesticides | Pest-OCHs | Insecticides | | | 2007-07-27 |
Mirex(Surrogate) | Surrogate: Mirex | 2385855 | Organics | Pesticides | | | | | 2013-06-17 |
Mirex-13C10(IsoDilAnalogue) | Isotopic Dilution Analogue: Mirex-13C10 | 0 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
Mirex-13C10(Surrogate) | Surrogate: Mirex-13C10 | 0 | Organics | Pesticides | | | | | 2014-01-28 |
Miscellaneous | Miscellaneous using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Miscellaneous, Other | Miscellaneous, Other | 0 | Debris | Trash | Plastics | Miscellaneous | | | 2014-11-04 |
Moisture | Moisture | 0 | Organics | Inorganics | Conventionals | | | | 2007-07-27 |
Molinate | Molinate (Ordram) | 2212671 | Organics | Pesticides | Pest-OPs | | | | 2007-07-27 |
Molinate sulfoxide | Molinate sulfoxide | 52236290 | Organics | Pesticides | | | | | 2017-04-20 |
Molybdenum | Molybdenum | 7439987 | Inorganics | Metals | | | | | 2007-07-27 |
Molybdenum, Acid Labile | Acid Labile Molybdenum | 0 | Inorganics | Metals | | | | | 2010-11-11 |
Monobromophenyl-hexachloro-norbornene-1 | Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 1) | 0 | Organics | FlameRetardants | | | | | 2015-07-16 |
Monobromophenyl-hexachloro-norbornene-2 | Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 2) | 0 | Organics | FlameRetardants | | | | | 2015-07-16 |
Monobromophenyl-hexachloro-norbornene-3 | Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 3) | 0 | Organics | FlameRetardants | | | | | 2015-07-16 |
Monobutyltin as Sn | Monobutyltin as Sn (MBT) | 78763549 | Organics | Organotins | Biocide | | | | 2010-06-21 |
Monocrotophos | Monocrotophos | 6923224 | Organics | Pesticides | Insecticides | Organophosphorous | | | 2014-01-28 |
Mono-dechlorinated Dechlorane Plus | Mono-dechlorinated Dechlorane Plus (C11-DP) | 0 | Organics | FlameRetardants | | | | | 2014-03-13 |
Monomethyl tetrachloroterephthalate | Monomethyl tetrachloroterephthalate (MTP) | 887547 | Organics | Pesticides | | | | | 2017-04-10 |
Monomethylarsonic Acid | Monomethylarsonic Acid | 0 | Inorganics | Metals | | | | | 2014-01-29 |
Monuron | Monuron | 150685 | Organics | Pesticides | Pest-Carbamates | Herbicides | | | 2007-07-27 |
Monuron(Surrogate) | Surrogate: Monuron | 150685 | | | | | | | 2016-12-21 |
Monuron-TCA | Monuron-TCA | 140410 | Organics | Pesticides | | | | | 2017-04-20 |
Morphine | Morphine | 57272 | | | | | | | 2021-05-07 |
Mortality/Abnormality | Mortality/Abnormality (%) | 0 | Toxicity | | | | | | 2007-07-27 |
Mortality/Normality | Mortality/Normality (%) | 0 | Toxicity | | | | | | 2007-07-27 |
Motor Oil | Motor Oil | 0 | Organics | PAHs | | | | | 2014-01-28 |
Mountain Bikes Extent | Mountain Bikes Extent | 0 | Habitat | | | | | | 2019-05-07 |
Mountain Bikes Intensity | Mountain Bikes Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Mountain Bikes Proximity | Mountain Bikes Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Mowing/Cutting Extent | Mowing/Cutting Extent | 0 | Habitat | | | | | | 2019-05-07 |
Mowing/Cutting Intensity | Mowing/Cutting Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Mowing/Cutting Proximity | Mowing/Cutting Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Musk Ambrette | Musk Ambrette | 0 | Organics | Musk | | | | | 2013-05-29 |
Musk Ketone | Musk Ketone | 0 | Organics | Musk | | | | | 2013-05-29 |
Musk Moskene | Musk Moskene | 0 | Organics | Musk | | | | | 2013-05-29 |
Musk Xylene | Musk Xylene | 0 | Organics | Musk | | | | | 2013-05-29 |
Mutagenicity | Mutagenicity | 0 | Toxicity | | | | | | 2007-07-27 |
Myclobutanil | Myclobutanil | 88671890 | Organics | Fungicides | | | | | 2016-05-20 |
N,N-Diethyl-3-methyl-benzamide-d7(Surrogate) | Surrogate: N,N-Diethyl-3-methyl-benzamide-d7 | 0 | Organics | PPCPs | | | | | 2013-05-30 |
N,N-Diethyl-3-methyl-benzamide-d7, N,N-(Surrogate) | Surrogate: N,N-Diethyl-3-methyl-benzamide-d7 | 0 | Organics | PPCPs | | | | | 2013-05-29 |
Nabam | Nabam | 0 | Organics | Pesticides | Fungicides | | | | 2017-04-04 |
Nail/Screw/Bolt | Nail/Screw/Bolt | 0 | Debris | Trash | Non-Plastics | Metals | | | 2014-11-04 |
Naled | Naled (Dibrom) | 300765 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2007-07-27 |
Naphthalene | Naphthalene | 91203 | Organics | PAHs | SVOCs | LMW_PAH | | | 2007-07-27 |
Naphthalene-d8(Surrogate) | Surrogate: Naphthalene-d8 | 1146652 | Organics | PAHs | SVOCs | Insecticides | | | 2007-07-27 |
Naphthalenes, C1- | C1-Naphthalenes | 0 | Organics | PAHs | SVOCs | LMW_PAH | | | 2010-06-21 |
Naphthalenes, C2- | C2-Naphthalenes | 0 | Organics | PAHs | SVOCs | LMW_PAH | | | 2010-06-21 |
Naphthalenes, C3- | C3-Naphthalenes | 0 | Organics | PAHs | SVOCs | LMW_PAH | | | 2010-06-21 |
Naphthalenes, C4- | C4-Naphthalenes | 0 | Organics | PAHs | SVOCs | LMW_PAH | | | 2010-06-21 |
Naphthobenzothiophene | Naphthobenzothiophene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Naphthobenzothiophene, C1- | C1-Naphthobenzothiophene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Naphthobenzothiophene, C2- | C2-Naphthobenzothiophene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Naphthobenzothiophene, C3- | C3-Naphthobenzothiophene | 0 | Organics | PAHs | | | | | 2014-01-28 |
Naphthylamine, 2- | 2-Naphthylamine | 0 | | | | | | | 2017-11-08 |
Napropamide | Napropamide | 15299997 | Organics | Pesticides | Herbicides | | | | 2013-05-28 |
Naproxen | Naproxen | 22204531 | Organics | PPCPs | | | | | 2010-04-26 |
Naproxen-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Naproxen-d3 | 958293771 | Organics | | | | | | 2022-07-22 |
Naproxen-d3-13C(Surrogate) | Surrogate: Naproxen-d3-13C | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Naptalam, sodium salt | Naptalam, sodium salt | 132672 | Organics | Pesticides | | | | | 2017-04-10 |
Napthalene | Napthalene | 0 | Organics | | | | | | 2016-12-21 |
Natural, cotton/wool | Natural, cotton/wool | 0 | Debris | Trash | Non-Plastics | Biodegradable | | | 2014-11-04 |
Neburon | Neburon | 555373 | Organics | Pesticides | Pest-Carbamates | Herbicides | | | 2007-07-27 |
Neodymium | Neodymium | 7440008 | Inorganics | | | | | | 2013-05-20 |
Nest | Nest (%) | 0 | Toxicity | | | | | | 2007-07-27 |
Nickel | Nickel | 7440020 | Inorganics | TraceElements | Metals | | | | 2007-07-27 |
Nicosulfuron | Nicosulfuron | 111991094 | Organics | Herbicides | | | | | 2013-05-20 |
NID as CTAS | 4-Nitro-Inden-1-One (NID) as Cobalt Thiocyanate Active Substances (CTAS) | 0 | | | | | | | 2016-12-23 |
Nifedipine | Nifedipine | 21829254 | | | | | | | 2021-05-07 |
Niobium | Niobium | 7440031 | Inorganics | | | | | | 2013-05-20 |
Nitenpyram | Nitenpyram | 120738898 | Organics | Pesticides | Insecticides | Neonics | | | 2017-10-05 |
Nitralin | Nitralin | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Nitrapyrin | Nitrapyrin | 1929824 | Organics | Pesticides | | | | | 2017-04-04 |
Nitrate + Nitrite as N | Nitrate + Nitrite as N | 0 | Inorganics | Conventionals | Nutrients | | | | 2013-05-28 |
Nitrate as N | Nitrate as N | 14797558 | Inorganics | Conventionals | Nutrients | WaterQualityMeasurements | | | 2007-07-27 |
Nitrate as NO3 | Nitrate as Nitrate | 14797558 | Inorganics | Conventionals | | | | | 2016-05-20 |
Nitrite as N | Nitrite as N | 14797650 | Inorganics | Conventionals | Nutrients | | | | 2007-07-27 |
Nitroaniline, 2- | 2-Nitroaniline | 88744 | Organics | SVOCs | | | | | 2007-07-27 |
Nitroaniline, 3- | 3-Nitroaniline | 99092 | Organics | SVOCs | | | | | 2007-07-27 |
Nitroaniline, 4- | 4-Nitroaniline | 100016 | Organics | SVOCs | | | | | 2007-07-27 |
Nitrobenzene | Nitrobenzene | 98953 | Organics | VOCs | | | | | 2007-07-27 |
Nitrobenzene-d5(Surrogate) | Surrogate: Nitrobenzene-d5 | 4165600 | Organics | VOCs | | | | | 2016-03-02 |
Nitrofen | Nitrofen | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Nitrogen Oxide | Nitrogen Oxide | 10102439 | Inorganics | Conventionals | | | | | 2014-01-22 |
Nitrogen, Inorganic | Inorganic Nitrogen as N | 0 | Inorganics | | | | | | 2012-10-29 |
Nitrogen, Organic | Organic Nitrogen as N | 7727379 | Inorganics | Conventionals | Nutrients | | | | 2012-01-11 |
Nitrogen, Total | Total Nitrogen | 0 | Inorganics | Conventionals | Nutrients | WaterQualityMeasurements | | | 2011-11-10 |
Nitrogen, Total Kjeldahl | Total Kjeldahl Nitrogen (TKN) | 7727379 | Inorganics | Conventionals | Nutrients | | | | 2007-07-27 |
Nitrogen-15 | Nitrogen-15 | 29817796 | Organics | Radiochemistry | | | | | 2014-11-05 |
Nitrogen-15/Nitrogen-14 Ratio | Nitrogen-15/Nitrogen-14 Ratio (Delta 15N nitrate isotope) | 0 | | | | | | | 2019-03-26 |
Nitrophenol, 2- | 2-Nitrophenol | 88755 | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | | 2007-07-27 |
Nitrophenol, 2-(Surrogate) | Surrogate: 2-Nitrophenol | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Nitrophenol, 4- | 4-Nitrophenol | 100027 | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | | 2007-07-27 |
Nitrophenol, 4-(Surrogate) | Surrogate: 4-Nitrophenol | 0 | Organics | SVOCs | | | | | 2016-05-20 |
Nitrosodiethylamine, N- | N-Nitrosodiethylamine | 0 | Organics | VOCs | | | | | 2017-03-29 |
Nitrosodimethylamine, N- | N-Nitrosodimethylamine | 0 | Organics | SVOCs | | | | | 2014-01-29 |
Nitrosodimethylamine-d6, N-(Surrogate) | Surrogate: N-Nitrosodimethylamine-d6 | 0 | Organics | SVOCs | | | | | 2017-03-29 |
Nitrosodi-n-propylamine, N- | N-Nitrosodi-n-propylamine | 621647 | Organics | SVOCs | | | | | 2007-07-27 |
Nitrosodiphenylamine, N- | N-Nitrosodiphenylamine | 0 | Organics | SVOCs | | | | | 2014-01-29 |
Nitrosomethylethylamine, N- | N-Nitrosomethylethylamine | 0 | Organics | SVOCs | | | | | 2017-03-29 |
No Debris Collected | No Debris Collected | 0 | Debris | Trash | Survey | | | | 2014-11-04 |
No Debris Present | No Debris Present | 0 | Debris | Trash | Survey | | | | 2014-11-04 |
Nodularin | Nodularin | 118399227 | Microbiological | Cyanotoxins | | | | | 2012-05-22 |
NoItems | Number of Items using Trash Protocol | 0 | Trash | | | | | | 2011-05-04 |
Nonachlor, cis- | cis-Nonachlor | 5103731 | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | | 2007-07-27 |
Nonachlor, cis-(Surrogate) | Surrogate: cis-Nonachlor | 0 | Organics | Pesticides | | | | | 2008-11-17 |
Nonachlor, cis-13C10(IsoDilAnalogue) | Isotopic Dilution Analogue: cis-Nonachlor-13C10 | 0 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
Nonachlor, trans- | trans-Nonachlor | 39765805 | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | | 2007-07-27 |
Nonachlor, trans-(Surrogate) | Surrogate: trans-Nonachlor | 0 | Organics | Pesticides | | | | | 2008-11-17 |
Nonachlor, trans-13C10(IsoDilAnalogue) | Isotopic Dilution Analogue: trans-Nonachlor-13C10 | 0 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
Nonacosane, n- | n-Nonacosane | 630035 | Organics | Alkanes | | | | | 2013-05-01 |
Nonadecane, n- | n-Nonadecane | 629925 | Organics | Alkanes | | | | | 2013-05-01 |
Nonane | Nonane (C9) | 111842 | Organics | | | | | | 2017-05-03 |
Nonane(Surrogate) | Surrogate: Nonane | 111842 | Organics | | | | | | 2017-08-10 |
None | Used for non-treated samples | 0 | WaterQualityMeasurements | ToxTreatment | | | | | 2007-07-27 |
NonPoint Source Discharges Stormwater Extent | NonPoint Source Discharges Stormwater Extent | 0 | Habitat | | | | | | 2019-05-07 |
NonPoint Source Discharges Stormwater Intensity | NonPoint Source Discharges Stormwater Intensity | 0 | Habitat | | | | | | 2019-05-07 |
NonPoint Source Discharges Stormwater Proximity | NonPoint Source Discharges Stormwater Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Nonylphenol | Nonylphenol | 25154523 | Organics | Surfactants | Phenols | non-Chlorinated Phenols | | | 2007-07-27 |
Nonylphenol diethoxylate | Nonylphenol diethoxylate | 20427843 | | | | | | | 2021-05-07 |
Nonylphenol Diethoxylate, 4- | 4-Nonylphenol Diethoxylate | 0 | Organics | PPCPs | | | | | 2013-05-29 |
Nonylphenol Diethoxylate, 4-(Surrogate) | Surrogate: 4-Nonylphenol Diethoxylate | 20427843 | | | | | | | 2020-09-04 |
Nonylphenol diethoxylate, tech- | tech-Nonylphenol diethoxylate | 0 | | | | | | | 2021-01-14 |
Nonylphenol Diethoxylate-13C6, 4-(Surrogate) | Surrogate: 4-Nonylphenol Diethoxylates-13C6 | 0 | Organics | PPCPs | | | | | 2013-05-29 |
Nonylphenol monoethoxylate | Nonylphenol monoethoxylate | 0 | | | | | | | 2021-01-14 |
Nonylphenol Monoethoxylate, 4- | 4-Nonylphenol Monoethoxylate | 0 | Organics | PPCPs | | | | | 2013-05-29 |
Nonylphenol monoethoxylate, 4-n- | 4-n-Nonylphenol monoethoxylate | 104358 | | | | | | | 2022-02-11 |
Nonylphenol Monoethoxylate-13C6, 4-(Surrogate) | Surrogate: 4-Nonylphenol Monoethoxylate-13C6 | 0 | Organics | PPCPs | | | | | 2013-05-29 |
Nonylphenol, 4-n- | 4-n-Nonylphenol | 104405 | Organics | Surfactants | | | | | 2016-05-20 |
Nonylphenol, p- | p-Nonylphenol | 0 | Organics | Surfactants | Phenols | | | | 2011-05-11 |
Nonylphenol, tech- | tech-Nonylphenol (Branched p-nonylphenol) | 84852153 | Organics | Surfactants | | | | | 2016-05-20 |
Nonylphenol-13C6, 4-n-(Surrogate) | Surrogate: 4-n-Nonylphenol-13C6 | 0 | Organics | PPCPs | | | | | 2013-06-25 |
Nonylphenol-13C6, n-4-(Surrogate) | Surrogate: 4-n-Nonylphenol-13C6 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Nonylphenol-d4, 4-(Surrogate) | Surrogate: 4-Nonylphenol-d4 | 1173019629 | Organics | | | | | | 2020-06-26 |
Nonylphenolethoxylate | Nonylphenolethoxylate | 9016459 | Organics | Surfactants | Phenols | non-Chlorinated Phenols | | | 2007-07-27 |
Norethisterone | Norethisterone | 68224 | | | | | | | 2021-05-07 |
Norfloxacin | Norfloxacin | 70458967 | Organics | PPCPs | | | | | 2010-04-26 |
Norfluoxetine | Norfluoxetine | 126924387 | Organics | PPCPs | | | | | 2010-04-26 |
Norfluoxetine-d5(Surrogate) | Surrogate: Norfluoxetine-d5 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Norflurazon | Norflurazon (3(2H)-Pyridazinone, 4-chloro-5-(methylamino)-2-[3-(trifluoromethyl)phenyl]-) (Telok) | 27314132 | Organics | Pesticides | Herbicides | | | | 2013-05-20 |
Norgestimate | Norgestimate | 35189287 | Organics | PPCPs | | | | | 2010-04-26 |
Normal Development | Normal Development (%) | 0 | Toxicity | | | | | | 2007-07-27 |
Norverapamil | Norverapamil | 67018853 | Organics | PPCPs | | | | | 2010-04-26 |
Not Characterized Fiber | Fiber particle not attempted to be characterized by spectroscopy | 0 | Microdebris | Unknown | Unknown | | | | 1900-01-01 |
Not Characterized Fiber Bundle | Fiber bundle particle not attempted to be characterized by spectroscopy | 0 | Microdebris | Unknown | Unknown | | | | 1900-01-01 |
Not Characterized Film | Film particle not attempted to be characterized by spectroscopy | 0 | Microdebris | Unknown | Unknown | | | | 1900-01-01 |
Not Characterized Foam | Foam particle not attempted to be characterized by spectroscopy | 0 | Microdebris | Unknown | Unknown | | | | 1900-01-01 |
Not Characterized Fragment | Fragment particle not attempted to be characterized by spectroscopy | 0 | Microdebris | Unknown | Unknown | | | | 1900-01-01 |
Not Characterized Sphere | Sphere particle not attempted to be characterized by spectroscopy | 0 | Microdebris | Unknown | Unknown | | | | 1900-01-01 |
Novaluron | Novaluron | 116714466 | Organics | Pesticides | Herbicides | | | | 2016-03-10 |
Noxious Chemical Odors Extent | Noxious Chemical Odors Extent | 0 | Habitat | | | | | | 2019-05-07 |
Noxious Chemical Odors Intensity | Noxious Chemical Odors Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Noxious Chemical Odors Proximity | Noxious Chemical Odors Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Nutrient Related Water Other Extent | Nutrient Related Water Other Extent | 0 | Habitat | | | | | | 2019-05-07 |
Nutrient Related Water Other Intensity | Nutrient Related Water Other Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Nutrient Related Water Other Proximity | Nutrient Related Water Other Proximity | 0 | Habitat | | | | | | 2019-05-07 |
NutrientSpike | Combination of multiple nutrients; see tox test comments for specific analytes and concentrations | 0 | Tox Treatment | | | | | | 2021-08-20 |
Nylon Fiber | Nylon Fiber | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Nylon Film | Nylon Film | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Nylon Foam | Nylon Foam | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Nylon Fragment | Nylon Fragment | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
Nylon Sphere | Nylon Sphere | 0 | Microdebris | Anthropogenic | Plastic | | | | 1900-01-01 |
O,O,O-Triethyl phosphorothioate | O,O,O-Triethyl phosphorothioate | 0 | | | | | | | 2017-01-12 |
ObservedChannelFlowLevel | ObservedChannelFlowLevel | 0 | FieldObservations | Habitat | | | | | 2011-05-31 |
ObservedFlow | ObservedFlow | 0 | FieldObservations | Habitat | | | | | 2009-08-20 |
Obstructions (culverts, paved stream crossings) Extent | Obstructions (culverts, paved stream crossings) Extent | 0 | Habitat | | | | | | 2019-05-07 |
Obstructions (culverts, paved stream crossings) Intensity | Obstructions (culverts, paved stream crossings) Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Obstructions (culverts, paved stream crossings) Proximity | Obstructions (culverts, paved stream crossings) Proximity | 0 | Habitat | | | | | | 2019-05-07 |
OCDD, 1,2,3,4,6,7,8,9- | 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD) | 3268879 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-05-28 |
OCDD, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD) | 3268879 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-06-02 |
OCDD-13C, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin-13C (OCDD) | 0 | Organics | DioxinsDibenzofurans | | | | | 2013-06-05 |
OCDF, 1,2,3,4,6,7,8,9- | 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF) | 39001020 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-05-28 |
OCDF, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF) | 39001020 | Organics | PCDDs/PCDFs | DioxinsDibenzofurans | | | | 2013-06-02 |
OCDF-13C, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran-13C (OCDF) | 0 | Organics | DioxinsDibenzofurans | | | | | 2013-06-05 |
Octabromo-1,3,3-trimethyl-1-phenylindane | Octabromo-1,3,3-trimethyl-1-phenylindane (OBIND) | 155613937 | Organics | FlameRetardants | | | | | 2014-03-13 |
Octachlorostyrene | Octachlorostyrene | 0 | Organics | VOCs | | | | | 2014-01-29 |
Octachlorostyrene-13C8(Surrogate) | Surrogate: Octachlorostyrene-13C8 | 0 | Organics | VOCs | | | | | 2014-01-29 |
Octacosane, n- | n-Octacosane | 0 | Organics | Alkanes | | | | | 2014-01-28 |
Octacosane, n-(Surrogate) | Surrogate: n-Octacosane | 0 | Organics | Alkanes | | | | | 2016-10-31 |
Octadecane, n- | n-Octadecane | 0 | Organics | Alkanes | | | | | 2014-01-28 |
Octamethylcyclotetrasiloxane | Octamethylcyclotetrasiloxane | 556672 | | | | | | | 2021-05-19 |
Octyl bicycloheptene dicarboximide, N- | N-Octyl bicycloheptene dicarboximide | 0 | Organics | Pesticides | | | | | 2017-04-04 |
Octylammonium Methanearsonate | Octylammonium Methanearsonate | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Octylphenol | Octylphenol | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Octylphenol diethoxylate, 4-n- | 4-n-Octylphenol diethoxylate | 51437902 | | | | | | | 2021-05-07 |
Octylphenol diethoxylate, tert-4- | 4-tert-Octylphenol diethoxylate (OP2EO) | 2315619 | Organics | Phenols | | | | | 2018-07-18 |
Octylphenol monoethoxylate, 4- | 4-Octylphenol monoethoxylate | 0 | | | | | | | 2021-01-14 |
Octylphenol monoethoxylate, 4-n- | 4-n-Octylphenol monoethoxylate | 51437899 | | | | | | | 2022-02-11 |
Octylphenol monoethoxylate, tert-4- | 4-tert-Octylphenol monoethoxylate (OP1EO) | 2315675 | Organics | Phenols | | | | | 2018-07-18 |
Octylphenol, 4- | 4-Octylphenol | 1806264 | | | | | | | 2018-08-31 |
Octylphenol, 4-n- | 4-n-Octylphenol | 1806264 | | | | | | | 2022-02-11 |
Octylphenol, tert-4- | 4-tert-Octylphenol | 140669 | Organics | Phenols | | | | | 2018-07-18 |
Odor | Odor | 0 | FieldObservations | Habitat | | | | | 2009-08-20 |
Odor Intensity | Odor Intensity - Specific to EMAP BA (characterizes intensity of odor) | 0 | Habitat | | | | | | 2009-08-20 |
Offspring | Offspring (#) | 0 | Toxicity | | | | | | 2007-07-27 |
Ofloxacin | Ofloxacin | 82419361 | Organics | PPCPs | | | | | 2010-04-26 |
Oil, Gas Wells | Oil, Gas Wells | 0 | Habitat | | | | | | 2009-08-20 |
OilandGrease; FOG-HEM | Oil and Grease; Fats, Oils and Grease N-Hexane Extractable Material (Polar Material) | 0 | Inorganics | | | | | | 2018-07-05 |
OilandGrease; HEM | Oil and Grease, N-Hexane Extractable Material | 0 | Organics | PAHs | | | | | 2013-09-24 |
OilandGrease; SGT-HEM | Oil and Grease, Silica Gel Treated N-Hexane Extractable Material (Non-Polar Material Not Adsorbed by Silica Gel) | 0 | Organics | PAHs | | | | | 2013-09-24 |
Okadaic Acid | Okadaic Acid | 78111178 | Microbiological | Cyanotoxins | | | | | 2013-05-28 |
Omethoate | Omethoate | 0 | Organics | Pesticides | Insecticides | | | | 2017-04-04 |
Open Shell Volume | Open Shell Volume (weight (in grams) of water displaced by each empty bivalve) | 0 | Organics | Inorganics | Metals | Conventionals | | | 2012-11-08 |
Orchards | Orchards | 0 | Habitat | | | | | | 2009-08-20 |
Orchards Extent | Orchards Extent | 0 | Habitat | | | | | | 2019-05-07 |
Orchards Intensity | Orchards Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Orchards Proximity | Orchards Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Organic natural material | Hair or other unprocessed natural fiber, fragment, film | 0 | Microdebris | Natural | Natural | Natural | | | 2018-04-26 |
Organic Natural Material Fiber | Organic natural material Fiber | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Organic Natural Material Film | Organic natural material Film | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Organic Natural Material Foam | Organic natural material Foam | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Organic Natural Material Fragment | Organic natural material Fragment | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Organic Natural Material Sphere | Organic natural material Sphere | 0 | Microdebris | Non-Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Ormetoprim | Ormetoprim | 0 | Organics | PPCPs | | | | | 2010-04-26 |
OrthoPhosphate as P | Reactive Phosphorous (PO4) | 14265442 | Inorganics | Conventionals | Nutrients | | | | 2007-07-27 |
Oryzalin | Oryzalin (Rycelan) (Ryzelan) (Surflan) | 19044883 | Organics | Herbicides | | | | | 2013-05-20 |
Osmoregulation | Osmoregulation | 0 | Toxicity | | | | | | 2007-07-27 |
o-Terphenyl(Surrogate) | Surrogate: o-Terphenyl | 84151 | Organics | SVOCs | | | | | 2016-03-02 |
OtherPresence | OtherPresence | 0 | FieldObservations | Habitat | | | | | 2009-08-20 |
Outfall Accessibility | Outfall Accessibility | 0 | | | | | | | 2016-06-13 |
Outfall Structural Cond | Structural condition of the outfall | 0 | | | | | | | 2016-06-17 |
Outfall, Distance from Transect | Outfall, Distance from Transect | 0 | Habitat | Debris | | | | | 2014-11-04 |
Outfall, Within Transect | Outfall, Within Transect | 0 | Habitat | Debris | | | | | 2014-11-04 |
OverlandRunoffLast24hrs | Influence of overland runoff during last 24 hours | 0 | FieldObservations | Habitat | | | Constituents | | 2011-02-09 |
Oxacillin | Oxacillin | 66795 | Organics | PPCPs | | | | | 2010-04-26 |
Oxadiazon | Oxadiazon | 19666309 | Organics | Pesticides | Pest-OCHs | | | | 2007-07-27 |
Oxamyl | Oxamyl | 23135220 | Organics | Pesticides | Pest-Carbamates | Insecticides | | | 2007-07-27 |
Oxathiapiprolin | Oxathiapiprolin | 1003318679 | Organics | Pesticides | Fungicides | | | | 2018-01-03 |
Oxidation-Reduction Potential | Oxidation-Reduction Potential (OPR) | 0 | WaterQualityMeasurements | Conventionals | | | | | 2016-05-20 |
Oxolinic Acid | Oxolinic Acid | 14698294 | Organics | PPCPs | | | | | 2010-04-26 |
Oxybenzone | Oxybenzone | 131577 | | | | | | | 2018-08-31 |
Oxycarboxin | Oxycarboxin | 5259881 | Organics | Pesticides | | | | | 2017-04-20 |
Oxychlordane | Oxychlordane | 27304138 | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | | 2007-07-27 |
Oxychlordane(Surrogate) | Surrogate: Oxychlordane | 0 | Organics | Pesticides | | | | | 2008-11-17 |
Oxychlordane-13C10(IsoDilAnalogue) | Isotopic Dilution Analogue: Oxychlordane-13C10 | 0 | Organics | Pest-OCHs | IDA | | | | 2023-06-19 |
Oxychlordane-13C10(Surrogate) | Surrogate: Oxychlordane-13C10 | 0 | Organics | Pesticides | | | | | 2013-06-17 |
Oxycodone | Oxycodone | 76426 | Organics | PPCPs | | | | | 2010-04-26 |
Oxycodone-d6(Surrogate) | Surrogate: Oxycodone-d6 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Oxydemeton-methyl | Oxydemeton-methyl | 301122 | Organics | Pesticides | | | | | 2017-04-20 |
Oxyfluorfen | Oxyfluorfen (Goal) | 42874033 | Organics | Pesticides | Pest-OCHs | | | | 2013-05-28 |
Oxygen, Dissolved | Dissolved Oxygen (DO) | 0 | WaterQualityMeasurements | Conventionals | | | | | 2009-08-20 |
Oxygen, Saturation | Oxygen, Saturation | 0 | WaterQualityMeasurements | Conventionals | | | | | 2007-07-27 |
Oxygen-18/Oxygen-16 Ratio | Oxygen-18/Oxygen-16 Ratio (Delta 18O nitrate isotope) | 14797718 | Isotopes | | | | | | 2013-05-20 |
Oxytetracycline | Oxytetracycline | 79572 | Organics | PPCPs | | | | | 2012-05-22 |
Oxythioquinox | Oxythioquinox (Chinomethionate) | 0 | Organics | Pesticides | Fungicides | | | | 2017-04-04 |
Paclobutrazol | Paclobutrazol | 76738620 | Organics | Pesticides | Fungicides | | | | 2016-03-10 |
Paint Fiber | Paint Fiber | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Paint Film | Paint Film | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Paint Foam | Paint Foam | 0 | Microdebris | Anthropogenic | Non-Plastic | | | | 1900-01-01 |
Paint fragment | Paint anthropogenic fragment | 0 | Microdebris | Anthropogenic | Paint | Fragment | | | 2018-04-26 |
Paper/Cardboard | Paper/Cardboard | 0 | Debris | Trash | Non-Plastics | Biodegradable | | | 2014-11-04 |
PAR | Photosynthetically Active Radiation (PAR) | 0 | WaterQualityMeasurements | | | | | | 2007-07-27 |
Paraoxon | Paraoxon | 0 | Organics | Pesticides | Insecticides | | | | 2008-11-07 |
Paraquat | Paraquat | 4685147 | Organics | Pesticides | Herbicides | | | | 2013-03-14 |
Paraquat Bis(methylsulfate) | Paraquat Bis(methylsulfate) | 0 | Organics | Pesticides | Herbicides | | | | 2017-04-04 |
Paraquat Dichloride | Paraquat Dichloride | 1910425 | Organics | Pesticides | Herbicides | | | | 2013-05-28 |
Parathion, Ethyl | Ethyl Parathion (Parathion) | 56382 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2013-05-28 |
Parathion, Methyl | Methyl Parathion | 298000 | Organics | Pesticides | Pest-OPs | Insecticides | | | 2013-05-28 |
Parathion, Total | Total Parathion | 0 | | | | | | | 2016-12-23 |
Parking Lot/Pavement Extent | Parking Lot/Pavement Extent | 0 | Habitat | | | | | | 2019-05-07 |
Parking Lot/Pavement Intensity | Parking Lot/Pavement Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Parking Lot/Pavement Proximity | Parking Lot/Pavement Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Parks, Campgrounds | Parks, Campgrounds | 0 | Habitat | | | | | | 2009-08-20 |
Paroxetine | Paroxetine | 61869087 | Organics | PPCPs | | | | | 2010-04-26 |
Paroxetine-d6(Surrogate) | Surrogate: Paroxetine-d6 | 0 | Organics | PPCPs | | | | | 2010-04-26 |
Particulate Organic Carbon | Particulate Organic Carbon (POC) | 0 | Inorganics | Conventionals | | | | | 2013-05-27 |
Particulate Organic Hydrogen | Particulate Organic Hydrogen | 0 | Inorganics | Conventionals | | | | | 2012-03-27 |
Passive Input (Construction/Erosion) Extent | Passive Input (Construction/Erosion) Extent | 0 | Habitat | | | | | | 2019-05-07 |
Passive Input (Construction/Erosion) Intensity | Passive Input (Construction/Erosion) Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Passive Input (Construction/Erosion) Proximity | Passive Input (Construction/Erosion) Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Pasture | Pasture | 0 | Habitat | | | | | | 2009-08-20 |
Pasture Extent | Pasture Extent | 0 | Habitat | | | | | | 2019-05-07 |
Pasture Intensity | Pasture Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Pasture Proximity | Pasture Proximity | 0 | Habitat | | | | | | 2019-05-07 |
Paved Roads Extent | Paved Roads Extent | 0 | Habitat | | | | | | 2019-05-07 |
Paved Roads Intensity | Paved Roads Intensity | 0 | Habitat | | | | | | 2019-05-07 |
Paved Roads Proximity | Paved Roads Proximity | 0 | Habitat | | | | | | 2019-05-07 |
PBB 001 | Polybrominated Biphenyl (PBB) 1 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 002 | Polybrominated Biphenyl (PBB) 2 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 003 | Polybrominated Biphenyl (PBB) 3 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 004 | Polybrominated Biphenyl (PBB) 4 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 007 | Polybrominated Biphenyl (PBB) 7 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 009 | Polybrominated Biphenyl (PBB) 9 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 010 | Polybrominated Biphenyl (PBB) 10 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 015 | Polybrominated Biphenyl (PBB) 15 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 018 | Polybrominated Biphenyl (PBB) 18 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 026 | Polybrominated Biphenyl (PBB) 26 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 030 | Polybrominated Biphenyl (PBB) 30 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 031 | Polybrominated Biphenyl (PBB) 31 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 049 | Polybrominated Biphenyl (PBB) 49 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 052 | Polybrominated Biphenyl (PBB) 52 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 053 | Polybrominated Biphenyl (PBB) 53 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 077 | Polybrominated Biphenyl (PBB) 77 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 080 | Polybrominated Biphenyl (PBB) 80 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 103 | Polybrominated Biphenyl (PBB) 103 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBB 155 | Polybrominated Biphenyl (PBB) 155 | 0 | Organics | FlameRetardants | | | | | 2012-03-29 |
PBDE 001 | Polybrominated Diphenyl Ether (PBDE) 1 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 001(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 1 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 002 | Polybrominated Diphenyl Ether (PBDE) 2 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 003 | Polybrominated Diphenyl Ether (PBDE) 3 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 003(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 3 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 004(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 4 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 007 | Polybrominated Diphenyl Ether (PBDE) 7 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 008 | Polybrominated Diphenyl Ether (PBDE) 8 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 008/11 | Polybrominated Diphenyl Ether (PBDE) 8/11 | 0 | Organics | PBDEs | FlameRetardants | | | | 2017-05-04 |
PBDE 010 | Polybrominated Diphenyl Ether (PBDE) 10 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 011 | Polybrominated Diphenyl Ether (PBDE) 11 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 012 | Polybrominated Diphenyl Ether (PBDE) 12 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 012/13 | Polybrominated Diphenyl Ether (PBDE) 12/13 | 0 | Organics | PBDEs | FlameRetardants | | | | 2017-05-04 |
PBDE 013 | Polybrominated Diphenyl Ether (PBDE) 13 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 015 | Polybrominated Diphenyl Ether (PBDE) 15 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 015(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 15 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 017 | Polybrominated Diphenyl Ether (PBDE) 17 | 49690940 | Organics | PBDEs | FlameRetardants | | | | 2007-07-27 |
PBDE 017/25 | Polybrominated Diphenyl Ether (PBDE) 17/25 | 0 | Organics | PBDEs | FlameRetardants | | | | 2013-06-25 |
PBDE 019(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 19 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 025 | Polybrominated Diphenyl Ether (PBDE) 25 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 028 | Polybrominated Diphenyl Ether (PBDE) 28 | 6430906 | Organics | PBDEs | FlameRetardants | | | | 2007-07-27 |
PBDE 028(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 28 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 028/33 | Polybrominated Diphenyl Ether (PBDE) 28/33 | 0 | Organics | PBDEs | FlameRetardants | | | | 2013-06-25 |
PBDE 028-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 028-13C12 | 0 | Organics | | | | | | 2022-02-24 |
PBDE 028-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 28-13C12 | 0 | Organics | PBDEs | | | | | 2021-08-20 |
PBDE 030 | Polybrominated Diphenyl Ether (PBDE) 30 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 032 | Polybrominated Diphenyl Ether (PBDE) 32 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 033 | Polybrominated Diphenyl Ether (PBDE) 33 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 033(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 33 | 0 | Organics | FlameRetardants | | | | | 2014-01-28 |
PBDE 035 | Polybrominated Diphenyl Ether (PBDE) 35 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 037 | Polybrominated Diphenyl Ether (PBDE) 37 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 037(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 37 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 047 | Polybrominated Diphenyl Ether (PBDE) 47 | 5436431 | Organics | PBDEs | FlameRetardants | | | | 2007-07-27 |
PBDE 047(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 47 | 5436431 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 047-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 047-13C12 | 0 | Organics | | | | | | 2022-02-24 |
PBDE 047-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 47-13C12 | 0 | Organics | PBDEs | | | | | 2021-08-20 |
PBDE 049 | Polybrominated Diphenyl Ether (PBDE) 49 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 049/71 | Polybrominated Diphenyl Ether (PBDE) 49/71 | 0 | Organics | SVOCs | | | | | 2016-05-20 |
PBDE 051 | Polybrominated Diphenyl Ether (PBDE) 51 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 052(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 52 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 054(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 54 | 0 | Organics | FlameRetardants | | | | | 2011-05-11 |
PBDE 066 | Polybrominated Diphenyl Ether (PBDE) 66 | 84303457 | Organics | PBDEs | FlameRetardants | | | | 2007-07-27 |
PBDE 069-F(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 69-F | 0 | Organics | FlameRetardants | | | | | 2011-05-11 |
PBDE 071 | Polybrominated Diphenyl Ether (PBDE) 71 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 075 | Polybrominated Diphenyl Ether (PBDE) 75 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 077 | Polybrominated Diphenyl Ether (PBDE) 77 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 077(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 77 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 079 | Polybrominated Diphenyl Ether (PBDE) 79 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 081(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 81 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 085 | Polybrominated Diphenyl Ether (PBDE) 85 | 182346210 | Organics | PBDEs | FlameRetardants | | | | 2007-07-27 |
PBDE 099 | Polybrominated Diphenyl Ether (PBDE) 99 | 60348609 | Organics | PBDEs | FlameRetardants | | | | 2007-07-27 |
PBDE 099(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 99 | 0 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 099-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 099-13C12 | 0 | Organics | | | | | | 2022-02-24 |
PBDE 099-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 99-13C12 | 0 | Organics | PBDEs | | | | | 2021-08-20 |
PBDE 100 | Polybrominated Diphenyl Ether (PBDE) 100 | 97038976 | Organics | PBDEs | FlameRetardants | | | | 2007-07-27 |
PBDE 100(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 100 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 100-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 100-13C12 | 0 | Organics | | | | | | 2022-02-24 |
PBDE 100-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-13C12 | 0 | Organics | PBDEs | | | | | 2021-08-20 |
PBDE 100-L(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-Labeled | 0 | Organics | PBDEs | FlameRetardants | | | | 2011-11-29 |
PBDE 104(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 104 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 105 | Polybrominated Diphenyl Ether (PBDE) 105 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 105(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 105 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 111(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 111 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 114(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 114 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 116 | Polybrominated Diphenyl Ether (PBDE) 116 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 118 | Polybrominated Diphenyl Ether (PBDE) 118 | 0 | Organics | FlameRetardants | | | | | 2012-04-03 |
PBDE 118(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 118 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 119 | Polybrominated Diphenyl Ether (PBDE) 119 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 119/120 | Polybrominated Diphenyl Ether (PBDE) 119/120 | 0 | Organics | PBDEs | FlameRetardants | | | | 2017-05-04 |
PBDE 120 | Polybrominated Diphenyl Ether (PBDE) 120 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 123(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 123 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 126 | Polybrominated Diphenyl Ether (PBDE) 126 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 126(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 126 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 128 | Polybrominated Diphenyl Ether (PBDE) 128 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 138 | Polybrominated Diphenyl Ether (PBDE) 138 | 67888986 | Organics | PBDEs | FlameRetardants | | | | 2007-07-27 |
PBDE 138(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 138 | 0 | Organics | FlameRetardants | | | | | 2009-08-14 |
PBDE 138/166 | Polybrominated Diphenyl Ether (PBDE) 138/166 | 0 | Organics | PBDEs | FlameRetardants | | | | 2017-05-04 |
PBDE 139 | Polybrominated Diphenyl Ether (PBDE) 139 | 0 | Organics | FlameRetardants | | | | | 2009-01-08 |
PBDE 139(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 139 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 139-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 139-13C12 | 0 | Organics | | | | | | 2022-02-24 |
PBDE 139-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 139-13C12 | 0 | Organics | PBDEs | | | | | 2021-08-20 |
PBDE 140 | Polybrominated Diphenyl Ether (PBDE) 140 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 140(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 140 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 153 | Polybrominated Diphenyl Ether (PBDE) 153 | 68631492 | Organics | PBDEs | FlameRetardants | | | | 2007-07-27 |
PBDE 153(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 153 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 153-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 153-13C12 | 0 | Organics | | | | | | 2022-02-24 |
PBDE 153-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 153-13C12 | 0 | Organics | PBDEs | | | | | 2021-08-20 |
PBDE 154 | Polybrominated Diphenyl Ether (PBDE) 154 | 36402150 | Organics | PBDEs | FlameRetardants | | | | 2007-07-27 |
PBDE 154(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 154 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 154-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 154-13C12 | 0 | Organics | | | | | | 2022-02-24 |
PBDE 154-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 154-13C12 | 0 | Organics | PBDEs | | | | | 2021-08-20 |
PBDE 155 | Polybrominated Diphenyl Ether (PBDE) 155 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 155(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 155 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 156(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 156 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 157(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 157 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 160 | Polybrominated Diphenyl Ether (PBDE) 160 | 0 | Organics | SVOCs | | | | | 2016-05-20 |
PBDE 166 | Polybrominated Diphenyl Ether (PBDE) 166 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 167(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 167 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 169(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 169 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 170(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 170 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 172(Surrogate) | Surrogate: PBDE 172
Surrogate: PBDE 172 | 0 | | | | | | | 2019-06-11 |
PBDE 178(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 178 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 179 | Polybrominated Diphenyl Ether (PBDE) 179 | 0 | Organics | FlameRetardants | | | | | 2010-11-08 |
PBDE 180(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 180 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 181 | Polybrominated Diphenyl Ether (PBDE) 181 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 183 | Polybrominated Diphenyl Ether (PBDE) 183 | 68928803 | Organics | PBDEs | FlameRetardants | | | | 2007-07-27 |
PBDE 183(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 183 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 183-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 183-13C12 | 0 | Organics | | | | | | 2022-02-24 |
PBDE 183-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 183-13C12 | 0 | Organics | PBDEs | | | | | 2021-08-20 |
PBDE 184 | Polybrominated Diphenyl Ether (PBDE) 184 | 0 | Organics | FlameRetardants | | | | | 2010-11-08 |
PBDE 188 | Polybrominated Diphenyl Ether (PBDE) 188 | 0 | Organics | FlameRetardants | | | | | 2010-11-08 |
PBDE 188(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 188 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 189(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 189 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 190 | Polybrominated Diphenyl Ether (PBDE) 190 | 79682250 | Organics | PBDEs | FlameRetardants | | | | 2007-07-27 |
PBDE 194 | Polybrominated Diphenyl Ether (PBDE) 194 | 0 | Organics | FlameRetardants | | | | | 2012-04-03 |
PBDE 195 | Polybrominated Diphenyl Ether (PBDE) 195 | 0 | Organics | FlameRetardants | | | | | 2012-04-03 |
PBDE 196 | Polybrominated Diphenyl Ether (PBDE) 196 | 0 | Organics | FlameRetardants | | | | | 2009-08-14 |
PBDE 197 | Polybrominated Diphenyl Ether (PBDE) 197 | 0 | Organics | FlameRetardants | | | | | 2009-01-08 |
PBDE 197(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 197 | 0 | Organics | FlameRetardants | | | | | 2009-08-14 |
PBDE 198 | Polybrominated Diphenyl Ether (PBDE) 198 | 0 | Organics | FlameRetardants | | | | | 2012-04-03 |
PBDE 200 | Polybrominated Diphenyl Ether (PBDE) 200 | 0 | Organics | FlameRetardants | | | | | 2010-11-08 |
PBDE 200/203 | Polybrominated Diphenyl Ether (PBDE) 200/203 | 0 | Organics | PBDEs | FlameRetardants | | | | 2013-06-25 |
PBDE 201 | Polybrominated Diphenyl Ether (PBDE) 201 | 0 | Organics | FlameRetardants | | | | | 2010-11-08 |
PBDE 202 | Polybrominated Diphenyl Ether (PBDE) 202 | 0 | Organics | FlameRetardants | | | | | 2010-11-08 |
PBDE 202(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 202 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 203 | Polybrominated Diphenyl Ether (PBDE) 203 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 204 | Polybrominated Diphenyl Ether (PBDE) 204 | 0 | Organics | FlameRetardants | | | | | 2009-01-08 |
PBDE 205 | Polybrominated Diphenyl Ether (PBDE) 205 | 0 | Organics | FlameRetardants | | | | | 2009-01-08 |
PBDE 205(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 205 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 206 | Polybrominated Diphenyl Ether (PBDE) 206 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 206(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 206 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 207 | Polybrominated Diphenyl Ether (PBDE) 207 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 207(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 207 | 0 | Organics | FlameRetardants | | | | | 2009-08-14 |
PBDE 208 | Polybrominated Diphenyl Ether (PBDE) 208 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 208(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 208 | 0 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 209 | Polybrominated Diphenyl Ether (PBDE) 209 | 1163195 | Organics | FlameRetardants | | | | | 2008-11-17 |
PBDE 209(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 209 | 1163195 | Organics | FlameRetardants | | | | | 2010-07-14 |
PBDE 209-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 209-13C12 | 0 | Organics | | | | | | 2022-02-24 |
PBDE 209-13C12(Surrogate) | Surrog |