CEDEN Data Checker

CEDEN Checker Home Troubleshooting Lookup Lists Lookup Search

CEDEN LookUp List: AnalyteLookUp

AnalyteName	AnalyteDescr	CASNumber	Group1	Group2	Group3	Group4	AnalyteType1	AnalyteType2	LastUpdateDate
Chemical Group A	Total of (Aldrin,Dieldrin,Endrin,Heptachlor,Heptachlor Epoxide,Chlorine,HCH, Endosulfan,Toxaphene)	0	Organics	Pesticides					2016-05-20
[(Methylimino)dimethylidyne]di-2,4-xylidine, N,N'-	N,N'-[(Methylimino)dimethylidyne]di-2,4-xylidine (Amitraz)	0	Organics	Pesticides	Insecticides				2017-04-04
[DAsp3]Microcystin-RR	[Deaspartic?acid3] Microcystin-RR	0							2019-05-17
1,2-bis(2,4,6- tribromophenoxy)ethane	1,2-bis(2,4,6- tribromophenoxy)ethane (BTBPE)	37853591	Organics	FlameRetardants					2014-03-13
1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane	1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (DBE-DBCH)	3322938	Organics	FlameRetardants					2014-03-13
13C2-Perfluorooctanoic acid (PFOA)	13C2-Perfluorooctanoic acid (PFOA)	0							2020-12-02
13C3-HFPO-DA (Surrogate)	Surrogate: 13C3-Hexafluoropropylene oxide dimer acid	13252136	Organics						2022-07-22
13c8-Perfluorooctanesulfonic acid (PFOS)	13c8-Perfluorooctanesulfonic acid (PFOS)	0							2020-12-02
18a-Oleanane	18a-Oleanane	30759923	Organics	Hopanes					2014-01-28
2,2-bis(chloromethyl)propane-1,3-diyltetrakis(2-chloroethyl) bisphosphate	2,2-bis(chloromethyl)propane-1,3-diyltetrakis(2-chloroethyl) bisphosphate (V6)	38051104	Organics	FlameRetardants					2014-03-13
2,4,6-tribromophenyl allyl ether	2,4,6-tribromophenyl allyl ether (ATE)	3278895	Organics	FlameRetardants					2014-03-13
2-ethyl-1-hexyl-2,3,4,5-tetrabromobenzoate	2-ethyl-1-hexyl-2,3,4,5-tetrabromobenzoate (EHTBB)	183658277	Organics	FlameRetardants					2014-03-13
2-Ethylhexyl-diphenyl phosphate	2-Ethylhexyl-diphenyl phosphate (EHDPP)	1241947	Organics	FlameRetardants					2014-03-13
4-Aminophenylsulfonylcarbamic acid methyl ester, N-	N-(4-Aminophenyl)sulfonylcarbamic acid methyl ester (Asulam)	0	Organics	Pesticides	Herbicides				2017-04-04
4-chloro-2-methylphenyl-N,N-dimethylmethanimidamide, N'-	N'-(4-chloro-2-methylphenyl)-N,N-dimethylmethanimidamide (Chlordimeform)	6164983	Organics	Pesticides					2017-05-24
6-Pack Ring	6-Pack Ring	0	Debris	Trash	Plastics	FoodService			2014-11-04
Abamectin	Abamectin	71751412	Organics	Pesticides					2019-06-13
Abnormality	Abnormality (%)	0	Toxicity						2007-07-27
Abundance	Abundance	0	Toxicity						2007-07-27
AccesstoWaterbody_BikePath	AccesstoWaterbody_BikePath	0	Habitat	Debris					2014-11-04
AccesstoWaterbody_Fence	AccesstoWaterbody_Fence	0	Habitat	Debris					2014-11-04
AccesstoWaterbody_HeavyVegetation	AccesstoWaterbody_HeavyVegetation	0	Habitat	Debris					2014-11-04
AccesstoWaterbody_ParkingLot	AccesstoWaterbody_ParkingLot	0	Habitat	Debris					2014-11-04
AccesstoWaterbody_PicnicArea	AccesstoWaterbody_PicnicArea	0	Habitat	Debris					2014-11-04
AccesstoWaterbody_RestrictedAccessMaintenanceRoad	AccesstoWaterbody_RestrictedAccessMaintenanceRoad	0	Habitat	Debris					2014-11-04
AccesstoWaterbody_Roadway	AccesstoWaterbody_Roadway	0	Habitat	Debris					2014-11-04
AccesstoWaterbody_Walkway	AccesstoWaterbody_Walkway	0	Habitat	Debris					2014-11-04
Accumulation	Accumulation using Trash Protocol	0	Trash						2011-05-04
Acenaphthene	Acenaphthene	83329	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Acenaphthene-d10(Surrogate)	Surrogate: Acenaphthene-d10	15067262	Organics	PAHs	SVOCs	LMW_PAH			2016-03-02
Acenaphthenes, C1-	C1-Acenaphthenes	0	Organics	PAHs	LMW_PAH				2018-07-24
Acenaphthylene	Acenaphthylene	208968	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Acenaphthylene-d10(Surrogate)	Surrogate: Acenaphthylene-d10	0							2019-04-23
Acenaphthylene-d8(Surrogate)	Surrogate: Acenaphthylene-d8	208968	Organics	PAHs					2016-03-02
Acesulfame potassium	Acesulfame potassium	55589623							2021-05-07
Acetaminophen	Acetaminophen	103902	Organics	PPCPs					2010-04-26
Acetaminophen(Surrogate)	Surrogate: Acetaminophen	0	Organics						2017-03-06
Acetaminophen-13C2-15N(Surrogate)	Surrogate: Acetaminophen-13C2-15N	0	Organics	PPCPs					2016-03-02
Acetamiprid	Acetamiprid	135410207	Organics	Pesticides	Insecticides				2016-03-10
Acetamiprid-13C6(Surrogate)	Surrogate: Acetamiprid-13C6	0	Organics	Pesticides					2018-08-07
Acetamiprid-N-Desmethyl	Acetamiprid-N-Desmethyl	190604923	Organics	Pesticides					2018-08-07
Acetone	Acetone	67641	Organics	VOCs					2007-07-27
Acetophenone	Acetophenone	98862	Organics						2018-07-16
Acibenzolar-S-methyl	Acibenzolar-S-methyl	135158542	Organics	Pesticides	Fungicides				2016-03-10
Acid Mine Drainage Extent	Acid Mine Drainage Extent	0	Habitat						2019-05-07
Acid Mine Drainage Intensity	Acid Mine Drainage Intensity	0	Habitat						2019-05-07
Acid Mine Drainage Proximity	Acid Mine Drainage Proximity	0	Habitat						2019-05-07
Acid Neutralizing Capacity	Acid Neutralizing Capacity (ANC)	0	Inorganics	Conventionals					2012-09-13
Acid Volatile Sulfides	Acid Volatile Sulfides (AVS)	0	Inorganics	Conventionals					2012-09-13
Acifluorfen	Acifluorfen	50594666	Organics	Herbicides					2016-05-20
Acifluorfen Sodium	Acifluorfen Sodium	62476599	Organics	Pesticides					2017-04-10
Acrinathrin	Acrinathrin	0	Organics	Pesticides	Pest-Pyrethroids				2019-09-26
Acrolein	Acrolein	107028	Organics	OrganochlorinePesticides					2008-11-07
Acrylic fiber	Acrylic fiber, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fiber			2018-04-26
Acrylic Fiber Bundle	Acrylic Fiber Bundle	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Acrylic Film	Acrylic Film	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Acrylic Foam	Acrylic Foam	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Acrylic Fragment	Acrylic Fragment	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Acrylic Sphere	Acrylic Sphere	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Acrylonitrile	Acrylonitrile	107131	Organics	VOCs					2014-01-29
Acrylonitrile Butadiene Styrene Fiber	Acrylonitrile butadiene styrene Fiber	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Acrylonitrile Butadiene Styrene Film	Acrylonitrile butadiene styrene Film	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Acrylonitrile Butadiene Styrene Fragment	Acrylonitrile butadiene styrene Fragment	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Aesthetic Condition	Aesthetic Condition	0	Habitat	Debris					2014-11-04
AFDM_Algae	Ash Free Dry Mass primarily of Algae but other items may be weighed	0	Inorganics	Conventionals			Constituents		2011-10-26
Age	Age	0	Tissue						2009-08-20
Age Diversity and Natural Regeneration Metric	Metric assesses the age diversity and natural regeneration potential of woody species in the riparian and channel zones (excluding low-flow).	0	Habitat						2019-05-13
Age_Pond	Age (in years) of the pond if it is created	0	Habitat						2012-09-13
Agricultural Other Extent	Agricultural Other Extent	0	Habitat						2019-05-07
Agricultural Other Intensity	Agricultural Other Intensity	0	Habitat						2019-05-07
Agricultural Other Proximity	Agricultural Other Proximity	0	Habitat						2019-05-07
Agricultural Runoff Extent	Agricultural Runoff Extent	0	Habitat						2019-05-07
Agricultural Runoff Intensity	Agricultural Runoff Intensity	0	Habitat						2019-05-07
Agricultural Runoff Proximity	Agricultural Runoff Proximity	0	Habitat						2019-05-07
Air Traffic Extent	Air Traffic Extent	0	Habitat						2019-05-07
Air Traffic Intensity	Air Traffic Intensity	0	Habitat						2019-05-07
Air Traffic Proximity	Air Traffic Proximity	0	Habitat						2019-05-07
Alachlor	Alachlor (Lasso)	15972608	Organics	Herbicides	Endocrine Disruptors				2013-05-28
Alachlor ethanesulfonic acid	Alachlor ethanesulfonic acid (ESA)	142363539	Organics	Pesticides					2017-04-10
Alachlor oxanilic acid	Alachlor oxanilic acid (OXA)	0	Organics	Pesticides					2017-04-10
Albuterol	Albuterol	18559949	Organics	PPCPs					2010-04-26
Albuterol-d3(Surrogate)	Surrogate: Albuterol-d3	0	Organics	PPCPs					2016-03-02
Aldicarb	Aldicarb	116063	Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
Aldicarb Sulfone	Aldicarb Sulfone	1646884	Organics	Pesticides	Insecticides	Carbamates			2014-01-28
Aldicarb Sulfoxide	Aldicarb Sulfoxide	1646873	Organics	Pesticides	Insecticides	Carbamates			2014-01-28
Aldrin	Aldrin	309002	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
Aldrin(Surrogate)	Surrogate: Aldrin	309002	Organics	Pesticides					2016-03-02
Aldrin-13C12(Surrogate)	Surrogate: Aldrin-13C12	309002	Organics	Pesticides					2016-03-02
Algae	Algae for benthics	0	Habitat				CollectionDevice		2008-12-04
Algae Cover	Percent of stream's water surface upstream of sample location estimated to be covered with algae	0	FieldObservations	Habitat			Constituents		2010-03-03
Algae-attached	Percent of substrate in wetted channel upstream of sample location estimated to be covered with Algae-attached	0	FieldObservations	Habitat			Constituents		2011-11-02
Algae-floating Mats	Percent of stream's water surface upstream of sample location estimated to be covered with Algae-floating Mats	0	FieldObservations	Habitat			Constituents		2013-06-02
Algal Growth Potential as Chlorophyll a	Algal Growth Potential as Chlorophyll a	0	WaterQualityMeasurements	Conventionals					2018-02-07
Algal/Surface Mats/Benthic Algal Growth Extent	Algal/Surface Mats/Benthic Algal Growth Extent	0	Habitat						2019-05-07
Algal/Surface Mats/Benthic Algal Growth Intensity	Algal/Surface Mats/Benthic Algal Growth Intensity	0	Habitat						2019-05-07
Algal/Surface Mats/Benthic Algal Growth Proximity	Algal/Surface Mats/Benthic Algal Growth Proximity	0	Habitat						2019-05-07
Alkalinity as CaCO3	Alkalinity as CaCO3	471341	Inorganics	Conventionals	WaterQualityMeasurements	Habitat			2009-08-20
Allethrin	Allethrin	584792	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Alpha Linolenic Acid	Alpha Linolenic Acid	0	Organics	Omega Fatty Acid					2012-09-12
Alprazolam	Alprazolam	28981977	Organics	PPCPs					2010-04-26
Alprazolam-d5(Surrogate)	Surrogate: Alprazolam-d5	0	Organics	PPCPs					2010-04-26
Aluminum	Aluminum	7429905	Inorganics	TraceElements	Metals				2007-07-27
Aluminum Foil	Aluminum Foil	0	Debris	Trash	Non-Plastics	Metals			2014-11-04
Aluminum Phosphide	Aluminum Phosphide (Phostoxin or Fumitoxin)	0	Inorganics	Pesticides					2017-04-04
Aluminum, Organic Monomeric	Organic Monomeric Aluminum (Organic Reactive)	0	Inorganics	TraceElements	Metals				2013-05-21
Aluminum, Total Monomeric	Total Monomeric Aluminum (Organic + Inorganic Reactive)	0	Inorganics	TraceElements	Metals				2013-05-21
Aluminum/Steel Can	Aluminum/Steel Can	0	Debris	Trash	Non-Plastics	Metals			2014-11-04
Ametryn	Ametryn	834128	Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Amino-1,2,4-triazole, 3-	3-Amino-1,2,4-triazole (Amitrole)	0	Organics	Pesticides	Herbicides				2017-04-04
Amino-2-chloro-4(ethylamino)-s-triazine, 6-	6-Amino-2-chloro-4(ethylamino)-s-triazine (CEAT)	0	Organics	Pesticides					2017-04-04
Aminocarb	Aminocarb	2032599	Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
Aminopyralid	Aminopyralid	150114719	Organics	Herbicides					2016-05-20
Aminopyridine, 4-	4-Aminopyridine	504245	Organics	Pesticides					2017-04-20
Amitriptyline	Amitriptyline	50486	Organics	PPCPs					2010-04-26
Amitriptyline-d5(Surrogate)	Surrogate: Amitriptyline-d5	0	Organics	PPCPs					2016-03-02
Amitriptyline-d6(Surrogate)	Surrogate: Amitriptyline-d6	0	Organics	PPCPs					2018-01-18
Amlodipine	Amlodipine	88150429	Organics	PPCPs					2010-04-26
Ammonia as N	Ammonia as N	7664417	Inorganics	Conventionals	Nutrients				2007-07-27
Ammonia as N, Unionized	Unionized Ammonia as N	7664417	Inorganics	Conventionals	Nutrients				2012-06-22
Ammonia as NH3	Ammonia as NH3	7664417	Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			2007-07-27
Ammonia as NH3, Unionized	Unionized Ammonia as NH3	7664417	Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			2012-06-27
Ammonium as N	Ammonium as N (NH4)	0	Inorganics	Conventionals	Nutrients		Constituents		2010-04-21
Ammonium Chloride	Ammonium Chloride	0	Inorganics						2018-04-12
Amoxicillin	Amoxicillin	26787780							2018-08-20
AMPA	Aminomethyl Phosphonic Acid (AMPA)	1066519	Organics	Pesticides	Herbicides				2013-05-28
AMPA(Surrogate)	Surrogate: Aminomethyl Phosphonic Acid (AMPA)	77521290	Organics	Pesticides					2016-05-20
Amphetamine	Amphetamine	300629	Organics	PPCPs					2010-04-26
Amphetamine-d5(Surrogate)	Surrogate: Amphetamine-d5	0	Organics	PPCPs					2016-03-02
AnalysisWeight	Analysis weight of sample	0	Laboratory	Ancillary					2014-02-05
Anatoxin-A	Anatoxin-A	64285069	Microbiological	Cyanotoxins					2012-05-22
Andorostenedione	Andorostenedione	63058							2021-05-07
Androstane, 5-alpha-	5-alpha-Androstane	438222	Organics	PPCPs					2014-01-28
Angling Pressure	Angling Pressure	0	Habitat						2009-08-20
Anilazine	Anilazine	101053	Organics	Pesticides	Fungicides				2016-10-25
Aniline	Aniline (Aminobenzene)(Phenylamine)	0	Organics	VOCs					2016-05-20
Animal Burrows Extent	Animal Burrows Extent	0	Habitat						2019-05-07
Animal Burrows Intensity	Animal Burrows Intensity	0	Habitat						2019-05-07
Animal Burrows Proximity	Animal Burrows Proximity	0	Habitat						2019-05-07
AnimalPresence	describes presence of animals which may include tracks, scat, sounds or physical presence	0	FieldObservations	Habitat					2013-04-01
Anion-Cation Balance	Anion-Cation Balance	0	Inorganics						2017-03-29
AnoxicTransitionDepth	Depth of the oxic-anoxic transition zone, also called redox potential discontinuity	0	FieldObservations	Habitat					2018-02-20
Antennal segment	Antennal segment (#)	0	Toxicity						2007-07-27
Anthracene	Anthracene	120127	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Anthracene-d10(Surrogate)	Surrogate: Anthracene-d10	0	Organics	PAHs					2016-03-02
Anthraquinone	Anthraquinone	84651	Organics						2018-07-16
Anthropogenic (cellulosic) fiber	Cellulosic fiber (Cotton, Rayon, Modal, or Lyocell), that can be grouped under cellulosic fiber and is dyed or dyed.	0	Microdebris	Anthropogenic	Natural Based	Fiber			2018-04-26
Anthropogenic (cellulosic) Fiber Bundle	Anthropogenic (cellulosic) Fiber Bundle	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Anthropogenic (cellulosic) Film	Anthropogenic (cellulosic) Film	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Anthropogenic (cellulosic) Foam	Anthropogenic (cellulosic) Foam	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Anthropogenic (cellulosic) Fragment	Anthropogenic (cellulosic) Fragment	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Anthropogenic (cellulosic) Sphere	Anthropogenic (cellulosic) Sphere	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Anthropogenic (non-plastic) fragment	Fragment that is anthropogenic, confirmed as non-plastic including asphalt	0	Microdebris	Anthropogenic		Fragment			2018-04-26
Anthropogenic (plastic) fragment	Fragment that is anthropogenic, confirmed as plastic based on dye spectroscopy, but polymer type could not be identified	0	Microdebris	Anthropogenic	Plastics	Fragment			2018-04-26
Anthropogenic (protein base) Fiber	Anthropogenic (protein base) Fiber	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Anthropogenic (protein) fiber	Wool, hair, or silk fiber that can be grouped under protein fiber and is dyed or undyed	0	Microdebris	Anthropogenic	Natural Based	Fiber			2018-04-26
Anthropogenic (synthetic) fiber	Synthetic fiber that is dyed (e.g. monomers, polymer degradation products such as aromatic compounds and esters)	0	Microdebris	Anthropogenic		Fiber			2018-06-18
Anthropogenic (synthetic) Film	Anthropogenic (synthetic) Film	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Anthropogenic (synthetic) Foam	Anthropogenic (synthetic) Foam	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Anthropogenic (synthetic) Fragment	Anthropogenic (synthetic) Fragment	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Anthropogenic (synthetic) Sphere	Anthropogenic (synthetic) Sphere	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Anthropogenic (unknown base) fiber	Fiber that is anthropogenic because it is DYED, but material type could not be identified as plastic or natural	0	Microdebris	Anthropogenic		Fiber			2018-06-18
Anthropogenic (unknown base) Fiber Bundle	Anthropogenic (unknown base) Fiber Bundle	0	Microdebris	Anthropogenic	Unknown				1900-01-01
Anthropogenic (unknown base) Film	Anthropogenic (unknown base) Film	0	Microdebris	Anthropogenic	Unknown				1900-01-01
Anthropogenic (unknown base) Foam	Anthropogenic (unknown base) Foam	0	Microdebris	Anthropogenic	Unknown				1900-01-01
Anthropogenic (unknown base) fragment	Fragment that is anthropogenic, confirmed as plastic , but polymer type could not be identified	0	Microdebris	Anthropogenic	Plastics	Fragment			2018-04-26
Anthropogenic (unknown base) Sphere	Anthropogenic (unknown base) Sphere	0	Microdebris	Anthropogenic	Unknown				1900-01-01
Anthropogenic Alt Channel Modification SubMetric	Metric assesses the impact of anthropogenic alterations based on channel modification	0	Habitat						2019-05-13
Anthropogenic Alt Hydromodification SubMetric	Metric assesses the impact of anthropogenic alterations based on hydromodification and Channel Evolution Models (CEMS)	0	Habitat						2019-05-13
Anthropogenic Alterations to Channel Morph Metric	Metric assesses the impact of anthropogenic alterations to channel morphology through hydromodification and channel modification. Metric is an average of the two previous submetrics.	0	Habitat						2019-05-13
Antimony	Antimony	7440360	Inorganics	Metals	Metalloids				2007-07-27
Antipyrine	Antipyrine (Phenazone)	60800							2021-05-07
Appliance	Appliance	0	Debris	Trash	Non-Plastics	Large			2014-11-04
AquaticLife	AquaticLife using Trash Protocol	0	Trash						2011-05-04
Arachidonic	Arachidonic	0	Organics	Omega Fatty Acid					2012-09-12
Area	Area	0	Tissue	Habitat			CollectionDevice		2012-06-01
Arsenate	Arsenate	0	Inorganics	Metals					2014-01-29
Arsenic	Arsenic	7440382	Inorganics	TraceElements	Metals	Metalloids			2007-07-27
Arsenic, Inorganic	Inorganic Arsenic	7440382	Inorganics	TraceElements	Metals				2013-05-28
Arsenite	Arsenite	0	Inorganics	Metals					2014-01-29
Asbestos, Total	Total Asbestos	0	Inorganics	Conventionals					2012-09-13
ASCI_D	Score for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_cnt.spp.most.tol_pct_att	Percent of taxa attributed with tolerance value (QA metric) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_cnt.spp.most.tol_pred	Count of most tolerant algae taxa (predicted) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_cnt.spp.most.tol_raw	Count of most tolerant algae taxa (raw) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_cnt.spp.most.tol_scr	Count of most tolerant algae taxa (score) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_EpiRho.richness_pct_att	Percent of taxa attributed with genus (QA metric) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_EpiRho.richness_pred	Richness of Epithemia and Rhopalodia taxa (predicted) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_EpiRho.richness_raw	Richness of Epithemia and Rhopalodia taxa (raw) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_EpiRho.richness_scr	Richness of Epithemia and Rhopalodia taxa (score) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_NumberTaxa	Number of diatom taxa	0	Bioassessment						2021-01-28
ASCI_D_prop.spp.IndicatorClass_TN_low_pct_att	Percent of taxa attributed with nitrogen indicator value (QA metric) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_prop.spp.IndicatorClass_TN_low_pred	Proportion low total nitrogen indicator taxa (predicted) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_prop.spp.IndicatorClass_TN_low_raw	Proportion low total nitrogen indicator taxa (raw) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_prop.spp.IndicatorClass_TN_low_scr	Proportion low total nitrogen indicator taxa (score) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_prop.spp.Planktonic_pct_att	Percent of taxa attributed with habitat value (QA metric) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_prop.spp.Planktonic_pred	Proportion planktonic taxa (predicted) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_prop.spp.Planktonic_raw	Proportion planktonic taxa (raw) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_prop.spp.Planktonic_scr	Proportion planktonic taxa (score) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_prop.spp.Trophic.E_pct_att	Percent of taxa attributed with trophic indicator value (QA metric) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_prop.spp.Trophic.E_pred	Proportion eutrophic taxa (predicted) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_prop.spp.Trophic.E_raw	Proportion eutrophic taxa (raw) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_prop.spp.Trophic.E_scr	Proportion eutrophic taxa (score) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_Salinity.BF.richness_pct_att	Percent of taxa attributed with salinity value (QA metric) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_Salinity.BF.richness_pred	Richness of brackish/freshwater taxa (predicted) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_Salinity.BF.richness_raw	Richness of brackish/freshwater taxa (raw) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_Salinity.BF.richness_scr	Richness of brackish/freshwater taxa (score) for the Diatom Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_D_ValveCount	Total number of diatom valves reported in the input data (i.e., sum of BAResult)	0	Bioassessment						2021-01-28
ASCI_H	Score for the Hybrid (diatom and soft-bodied algae) Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_cnt.spp.IndicatorClass_TP_high_pct_att	Percent of taxa attributed phosphorus indicator value (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_cnt.spp.IndicatorClass_TP_high_pred	Count of high total phosphorus indicator taxa (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_cnt.spp.IndicatorClass_TP_high_raw	Count of high total phosphorus indicator taxa (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_cnt.spp.IndicatorClass_TP_high_scr	Count of high total phosphorus indicator taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_cnt.spp.most.tol_pct_att	Percent of taxa attributed with tolerance value (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_cnt.spp.most.tol_pred	Count of most tolerant algae taxa (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_cnt.spp.most.tol_raw	Count of most tolerant algae taxa (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_cnt.spp.most.tol_scr	Count of most tolerant algae taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_EpiRho.richness_pct_att	Percent of taxa attributed with genus (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_EpiRho.richness_pred	Richness of Epithemia and Rhopalodia taxa (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_EpiRho.richness_raw	Richness of Epithemia and Rhopalodia taxa (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_EpiRho.richness_scr	Richness of Epithemia and Rhopalodia taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_NumberTaxa	Number of diatom taxa + soft-bodied algae taxa in Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_OxyReD_DO_30.richness_pct_att	Percent of taxa attributed with oxygen tolerance value (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_OxyReD_DO_30.richness_pred	Richness of algae species with 30% oxygen tolerance (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_OxyReD_DO_30.richness_raw	Richness of algae species with 30% oxygen tolerance (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_OxyReD_DO_30.richness_scr	Richness of algae species with 30% oxygen tolerance (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_prop.spp.Planktonic_pct_att	Percent of taxa attributed with habitat value (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_prop.spp.Planktonic_pred	Proportion planktonic algae taxa (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_prop.spp.Planktonic_raw	Proportion planktonic algae taxa (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_prop.spp.Planktonic_scr	Proportion planktonic algae taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_prop.spp.Trophic.E_pct_att	Percent of taxa attributed with trophic indicator value (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_prop.spp.Trophic.E_pred	Proportion eutrophic algae taxa (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_prop.spp.Trophic.E_raw	Proportion eutrophic algae taxa (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_prop.spp.Trophic.E_scr	Proportion eutrophic algae taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_prop.spp.ZHR_pct_att	Proportion of taxa attributed for the Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa metric for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_prop.spp.ZHR_raw	Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (raw)	0	Bioassessment						2021-01-28
ASCI_H_prop.spp.ZHR_scr	Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_Salinity.BF.richness_pct_att	Percent of taxa attributed with salinity value (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_Salinity.BF.richness_pred	Richness of brackish/freshwater algae taxa (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_Salinity.BF.richness_raw	Richness of brackish/freshwater algae taxa (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_H_Salinity.BF.richness_scr	Richness of brackish/freshwater algae taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_S	Score for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_S_Biovolume	Total soft-bodied algae biovolume reported in the input data (i.e., sum of Result)	0	Bioassessment						2021-01-28
ASCI_S_EntityCount	Total number of soft-bodied algae entities reported in the input data (i.e., sum of BAResult)	0	Bioassessment						2021-01-28
ASCI_S_NumberTaxa	Number of soft-bodied algae taxa	0	Bioassessment						2021-01-28
ASCI_S_prop.spp.IndicatorClass_DOC_high_pct_att	Percent of taxa attributed with dissolved organic carbon indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_S_prop.spp.IndicatorClass_DOC_high_raw	Proportion high dissolved organic carbon indicator Algal species (raw)	0	Bioassessment						2021-01-28
ASCI_S_prop.spp.IndicatorClass_DOC_high_scr	Proportion high dissolved organic carbon indicator Algal species (score) for the Soft-bodied Agae Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_S_prop.spp.IndicatorClass_NonRef_pct_att	Percent of taxa attributed with reference/non-reference indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_S_prop.spp.IndicatorClass_NonRef_raw	Proportion non-reference indicator algae species (raw) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_S_prop.spp.IndicatorClass_NonRef_scr	Proportion non-reference indicator algae species (score) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_S_prop.spp.IndicatorClass_TP_high_pct_att	Percent of taxa attributed phosphorus indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_S_prop.spp.IndicatorClass_TP_high_raw	Proportion high total phosphorus indicator algae taxa (raw) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_S_prop.spp.IndicatorClass_TP_high_scr	Proportion high total phosphorus indicator Algal taxa (score) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_S_prop.spp.ZHR_pct_att	Proportion of taxa attributed for the Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa metric for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_S_prop.spp.ZHR_raw	Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (raw) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						2021-01-28
ASCI_S_prop.spp.ZHR_scr	Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (score) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						2021-01-28
Ash Free Dry Mass	Ash-Free Dry Mass (AFDM, AFDW)	0	Inorganics	Conventionals	Benthic		Constituents		2011-11-10
Asphalt Fragment	Asphalt Fragment	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Aspon	Aspon	3244904	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
AssemblageIDAlgaeSampleVolume	Volume of material and liquid to produce the soft algae assemblage (taxonomy) sample	0	Habitat						2009-10-29
AssemblageIDDiatomSampleVolume	Volume of material and liquid to produce the diatom assemblage (taxonomy) sample	0	Habitat						2009-10-29
Atenolol	Atenolol	29122687	Organics	PPCPs					2010-04-26
Atenolol-d7(Surrogate)	Surrogate: Atenolol-d7	0	Organics	PPCPs					2016-03-02
Atorvastatin	Atorvastatin	134523005	Organics	PPCPs					2010-04-26
Atraton	Atraton	1610179	Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Atrazine	Atrazine	1912249	Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Atrazine dealkylated	Atrazine dealkylated	0	Organics	Pesticides					2017-04-10
Atrazine-13C3(Surrogate)	Surrogate: Atrazine-13C3	0	Organics	Pesticides	Pest-Triazines				2016-03-02
Atrazine-d5(Surrogate)	Surrogate: Atrazine-d5	163165751	Organics	Pesticides	Pest-Triazines	Herbicides			2016-03-02
Atrazine-Desisopropyl-2-Hydroxy	Atrazine-Desisopropyl-2-Hydroxy	7313544	Organics	Omega Fatty Acid					2012-09-12
ATVs Extent	ATVs Extent	0	Habitat						2019-05-07
ATVs Intensity	ATVs Intensity	0	Habitat						2019-05-07
ATVs Proximity	ATVs Proximity	0	Habitat						2019-05-07
Autopart	Autopart	0	Debris	Trash	Non-Plastics	Metals			2014-11-04
Avoidance	Avoidance (%)	0	Toxicity						2007-07-27
Azinphos Ethyl	Azinphos Ethyl	2642719	Organics	Pesticides	Pest-OPs	Insecticides			2013-05-28
Azinphos Methyl	Azinphos Methyl (Guthion)	86500	Organics	Pesticides	Pest-OPs	Insecticides			2013-05-28
Azinphos Methyl oxon	Azinphos Methyl oxon	0	Organics	Pesticides					2018-03-04
Azinphos Methyl(Surrogate)	Surrogate: Azinphos Methyl	0	Organics	Pesticides	OrganophosphatePest.	Insecticides			2016-03-02
Azinphos-methyl oxygen analog	Azinphos-methyl oxygen analog	0	Organics	Pesticides					2017-04-10
Azithromycin	Azithromycin	83905015	Organics	PPCPs					2010-04-26
Azobenzene	Azobenzene (Diphenyl Diimide)	103333	Organics	SVOCs					2014-01-29
Azoxystrobin	Azoxystrobin	131860338	Pesticides	Fungicides					2012-06-21
Back Water	Back Water present	0	Habitat						2009-08-20
Backscatter	Backscatter - CTD casts	0	WaterQualityMeasurements	Ancillary					2014-02-05
Bacteriophage MS2	Bacteriophage MS2	0	Microbiological	Pathogens					2020-09-03
Bacteroidales, Canine (DogBact)	Canine Bacteroidales, Assay Name: DogBact	0							2021-12-17
Bacteroidales, Human (BacH)	Human Bacteroidales Marker BacH	0							2021-10-18
Bacteroidales, Human (HF183/BacR287)	Human Bacteroidales, Assay name: HF183/BacR287, 5'-ATCATGAGTTCACATGTCCG-3', 5'-CTTCCTCTCAGAACCCCTATCC-3'	0	Microbiological						2023-01-27
Bacteroidales, Human (HF183/BFDrev)	Human Bacteroidales, Assay name: HF183/BFDrev, 5' ATCATGAGTTCACATGTCCG 3', 5' CGTAGGAGTTTGGACCGTGT 3'	0							2022-09-14
Bacteroidales, Human (HF183TMCaMan)	Human Bacteroidales, Assay name: HF183TMCaMan, 5? ATCATGAGTTCACATGTCCG 3?, 5? CTTCCTCTCAGAACCCCTATCC 3?	0	Microbiological						2022-08-19
Bacteroidales, Human (HumM2)	Human Bacteroidales, Assay name: HumM2, 5'-CGTCAGGTTTGTTTCGGTATTG-3', 5'-TCATCACGTAACTTATTTATATGCATTAGC-3'	0	Microbiological						2023-01-27
Bacteroidales, Porcine (Pig2Bac)	Porcine Bacteroidales, Assay name: Pig2Bac	0	Microbiological						2022-02-11
Bag, Large/Retail	Bag, Large/Retail	0	Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Bag, Pet Waste	Bag, Pet Waste	0	Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Bag, Single Use Plastic	Bag, Single Use Plastic	0	Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Bag, Takeout	Bag, Takeout	0	Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Bags/Packaging	Bags/Packaging	0	Debris	Trash	Plastics				2014-11-05
Balloon, Latex	Balloon, Latex	0	Debris	Trash	Plastics	Miscellaneous			2014-11-04
Balloon, Mylar	Balloon, Mylar	0	Debris	Trash	Plastics	Miscellaneous			2014-11-04
Bandage/Bandaid	Bandage/Bandaid	0	Debris	Trash	Plastics	Miscellaneous			2014-11-04
Bank Angle	Bank Angle	0	Habitat						2009-08-20
Bank Cover	Bank Cover	0	Habitat						2012-05-22
Bank Stability	Bank Stability (score zone 5m up and 5m downstream of transect between bankfull - wetted width)	0	Habitat						2009-08-20
Bankfull Height	Bankfull Height	0	Habitat						2009-08-20
Bankfull Width	Bankfull Width	0	Habitat						2009-08-20
Bankfull Width Reach	Visual estimate of the average bankfull width of the reach	0	Habitat						2009-08-20
Bar Present	Bar Present	0	Habitat						2009-08-20
Bar Width	Bar Width	0	Habitat						2009-08-20
Barban	Barban	101279	Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Barban(Surrogate)	Surrogate: Barban	101279	Organics	Pesticides	Pest-Carbamates				2016-03-02
Barium	Barium	7440393	Inorganics	Metals					2007-07-27
Barometric Pressure	Barometric Pressure	0	Habitat						2011-11-01
Batteries, Large	Batteries, Large	0	Debris	Trash	Non-Plastics	Toxic			2014-11-04
Batteries, Small	Batteries, Small	0	Debris	Trash	Non-Plastics	Toxic			2014-11-04
Battery Voltage	Battery Voltage	0	FieldMeasure						2012-04-23
Bearing	Bearing	0	Habitat						2009-08-20
BeaufortScale	BeaufortScale	0	FieldObservations	Habitat					2009-08-20
Beaver Flow Modifications	Beaver Flow Modifications	0	Habitat						2009-08-20
Beaver Signs	Beaver Signs	0	Habitat						2009-08-20
Bendiocarb	Bendiocarb	22781233	Organics	Pesticides	Pest-Carbamates				2013-05-20
Bendroflumethiazide	Bendroflumethiazide	73483							2021-05-07
Benfluralin	Benfluralin	1861401	Organics	Pesticides	Herbicides				2016-03-10
Benomyl	Benomyl	17804352	Organics	Pesticides	Pest-Carbamates	Endocrine Disruptors			2007-07-27
Benomyl/Carbendazim	Benomyl/Carbendazim	0	Organics	Pesticides					2016-04-26
Bensulfuron Methyl	Bensulfuron Methyl	83055996	Organics	Pesticides	Pest-Carbamates				2013-05-20
Bensulide	Bensulide	741582	Organics	Herbicides					2016-05-20
Bentazon	Bentazon	25057890	Organics	Pesticides					2016-05-20
Benz(a)anthracene	Benz(a)anthracene	56553	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Benz(a)anthracene-d12(Surrogate)	Surrogate: Benz(a)anthracene-d12	1718532	Organics	PAHs	SVOCs	HMW_PAH			2016-03-02
Benz(a)anthracene-d12/Chrysene-d12(Surrogate)	Surrogate: Benz(a)anthracene-d12/Chrysene-d12	0	Organics	PAHs					2014-01-28
Benz(a)anthracenes/Chrysenes, C1-	C1-Benz(a)anthracenes/Chrysenes	0	Organics	PAHs					2014-01-28
Benz(a)anthracenes/Chrysenes, C2-	C2-Benz(a)anthracenes/Chrysenes	0	Organics	PAHs					2014-01-28
Benz(a)anthracenes/Chrysenes, C3-	C3-Benz(a)anthracenes/Chrysenes	0	Organics	PAHs					2014-01-28
Benz(a)anthracenes/Chrysenes, C4-	C4-Benz(a)anthracenes/Chrysenes	0	Organics	PAHs					2014-01-28
Benz(e)pyrene-d12(Surrogate)	Surrogate: Benz(e)pyrene-d12	205440820	Organics	PAHs	Semi-VOAs				2016-03-02
Benzaldehyde	Benzaldehyde	100527	Organics	VOCs					2014-01-29
Benzene	Benzene	71432	Organics	VOCs	MTBE_BTEX				2007-07-27
Benzidine	Benzidine	92875	Organics	SVOCs					2014-01-29
Benzo [a] Pyrene equivalents	Benzo [a] Pyrene equivalents	0	Organics	PAHs	SVOCs				2007-07-27
Benzo(a)fluoranthene	Benzo(a)fluoranthene	203338	Organics	PAHs	SVOCs				2012-05-22
Benzo(a)pyrene	Benzo(a)pyrene	50328	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Benzo(a)pyrene-d12(Surrogate)	Surrogate: Benzo(a)pyrene-d12	50328	Organics	PAHs					2016-03-02
Benzo(b)fluoranthene	Benzo(b)fluoranthene	205992	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Benzo(b)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12	93951985	Organics	PAHs					2016-03-02
Benzo(b)fluorene, 11H-	11H-Benzo(b)fluorene	243174							2019-04-23
Benzo(b/j/k)fluoranthene	Benzo(b)fluoranthene/Benzo(j)fluoranthene/Benzo(k)fluoranthene	0	Organics	PAHs	Semi-VOAs	HMW_PAH			2013-05-28
Benzo(b/j/k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12/Benzo(j)fluoranthene-d12/Benzo(k)fluoranthene-d12	0	Organics	PAHs					2013-05-28
Benzo(b/k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12/Benzo(k)fluoranthene-d12	0	Organics	PAHs					2013-05-28
Benzo(e)pyrene	Benzo(e)pyrene	192972	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Benzo(e)pyrene-d12(Surrogate)	Surrogate: Benzo(e)pyrene-d12	205440820	Organics	PAHs	SVOCs				2016-03-02
Benzo(g,h,i)perylene	Benzo(g,h,i)perylene	191242	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Benzo(g,h,i)perylene-d12(Surrogate)	Surrogate: Benzo(g,h,i)perylene-d12	93951667	Organics	PAHs	SVOCs	HMW_PAH			2016-03-02
Benzo(j)fluoranthene	Benzo(j)fluoranthene	0	Organics	PAHs					2008-11-07
Benzo(j/k)fluoranthene	Benzo(j)fluoranthene/Benzo(k)fluoranthene	0	Organics	PAHs	SVOCs	HMW_PAH			2013-04-10
Benzo(j/k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(j)fluoranthene-d12/Benzo(k)fluoranthene-d12	0	Organics	PAHs					2014-01-28
Benzo(k)fluoranthene	Benzo(k)fluoranthene	207089	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Benzo(k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(k)fluoranthene-d12	0	Organics	PAHs					2014-01-28
Benzobicyclon	Benzobicyclon pesticide	0							2017-12-12
Benzofluoranthenes/Benzopyrenes, C1-	C1-Benzofluoranthenes/Benzopyrenes	0	Organics	PAHs	Alkylated PAHs				2018-07-24
Benzofluoranthenes/Benzopyrenes, C2-	C2-Benzofluoranthenes/Benzopyrenes	0	Organics	PAHs	Alkylated PAHs				2018-07-24
Benzoic Acid	Benzoic Acid	0	Organics	Herbicides					2016-05-20
Benzophenone	Benzophenone	119619	Organics						2018-07-16
Benzothiophene	Benzothiophene	95158	Organics	PAHs					2014-01-28
Benzothiophene, C1-	C1-Benzothiophene	0	Organics	PAHs					2014-01-28
Benzothiophene, C2-	C2-Benzothiophene	0	Organics	PAHs					2014-01-28
Benzothiophene, C3-	C3-Benzothiophene	0	Organics	PAHs					2014-01-28
Benzotriazole, 1H	1H-Benzotriazole	95147							2021-05-07
Benzovindiflupyr	Benzovindiflupyr	1072957711	Organics						2018-07-16
Benzoylecgonine	Benzoylecgonine	519095	Organics	PPCPs					2010-04-26
Benzoylecgonine-d8(Surrogate)	Surrogate: Benzoylecgonine-d8	0	Organics	PPCPs					2016-03-02
Benztropine	Benztropine	86135	Organics	PPCPs					2010-04-26
Benztropine-d3(Surrogate)	Surrogate: Benztropine-d3	0	Organics	PPCPs					2016-03-02
Benzyl Alcohol	Benzyl Alcohol	0	Organics	VOCs					2016-05-20
Beryllium	Beryllium	7440417	Inorganics	Metals					2007-07-27
Betamethasone	Betamethasone	378449	Organics	PPCPs					2010-04-26
Bezafibrate	Bezafibrate	41859670							2021-05-07
Bicarbonate	Bicarbonate	71523	Inorganics	Conventionals			Constituents		2012-09-13
Bicarbonate Alkalinity as CaCO3	Bicarbonate Alkalinity as CaCO3	471341	Inorganics	Conventionals	WaterQualityMeasurements				1900-01-01
Bifenox	Bifenox	42576023	Organics	Pesticides	Herbicides				2016-10-25
Bifenthrin	Bifenthrin	82657043	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Bifenthrin, Total(Surrogate)	Surrogate: Total Bifenthrin	0							2022-06-07
Biodegradable	Biodegradeable using Trash Protocol	0	Trash						2011-05-04
Biodegradable, Other	Biodegradable, Other	0	Debris	Natural	Non-Plastics	Biodegradable			2014-11-04
Biohazard	Biohazard using Trash Protocol	0	Trash						2011-05-04
Bioluminescence (EC50)	Bioluminescence (EC50)	0	Toxicity						2007-07-27
Biomass (wt/orig indiv)	Biomass (weight/original individual)	0	Toxicity						2007-07-27
BiomassSampleVolume	Volume of material and liquid filtered to produce the biomass (Ash Free Dry Mass-AFDM) sample	0	Habitat						2009-10-29
Biphenyl	Biphenyl	92524	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Biphenyl-d10(Surrogate)	Surrogate: Biphenyl-d10	1486017	Organics	PAHs	SVOCs				2007-07-27
Biphenyls, C1-	C1-Biphenyls	0	Organics	PAHs	LMW_PAH				2018-07-24
Biphenyls, C2-	C2-Biphenyls	0	Organics	PAHs	LMW_PAH				2018-07-24
Bis(1,3-dichloro-2-propyl) phosphate	Bis(1,3-dichloro-2-propyl) phosphate (BDCPP)	72236727	Organics	FlameRetardants					2014-03-13
Bis(1H,1H,2H,2H-perfluorodecyl)phosphate	Bis(1H,1H,2H,2H-perfluorodecyl)phosphate (8:2 diPAP)	0	Organics	PFAS	PFC Precursor				2014-10-20
Bis(1H,1H,2H,2H-perfluorodecyl)phosphate-13C4(Surrogate)	Surrogate: Bis(1H,1H,2H,2H-perfluorodecyl)phosphate-13C4	0	Organics	PFAS	PFC Precursor				2014-10-30
Bis(1H,1H,2H,2H-perfluorooctyl)phosphate	Bis(1H,1H,2H,2H-perfluorooctyl)phosphate (6:2 diPAP)	0	Organics	PFAS	PFC Precursor				2014-10-20
Bis(1H,1H,2H,2H-perfluorooctyl)phosphate-13C4(Surrogate)	Surrogate: Bis(1H,1H,2H,2H-perfluorooctyl)phosphate-13C4	0	Organics	PFAS	PFC Precursor				2014-11-03
Bis(2,4,6-tribromophenoxy)ethane	Bis(2,4,6-tribromophenoxy)ethane	37853591	Organics	FlameRetardants					2010-01-04
Bis(2-chloro-1-methylethyl) ether	Bis(2-chloro-1-methylethyl) ether	0	Organics	SVOCs					2014-01-29
Bis(2-chloroethoxy)methane	Bis(2-chloroethoxy)methane	111911	Organics	SVOCs					2007-07-27
Bis(2-chloroethyl) phosphate	Bis(2-chloroethyl) phosphate (BCEP)	0	Organics	FlameRetardants					2014-03-13
Bis(2-chloroethyl)ether	Bis(2-chloroethyl)ether	111444	Organics	SVOCs					2007-07-27
Bis(2-chloroisopropyl) ether	Bis(2-chloroisopropyl) ether	39638329	Organics	SVOCs					2016-08-26
Bis(2-chloroisopropyl) phosphate	Bis(2-chloroisopropyl) phosphate (BCPP)	0	Organics	FlameRetardants					2014-03-13
Bis(2-ethly-1-hexyl)tetrabromophthalate	Bis(2-ethly-1-hexyl)tetrabromophthalate (BEHTBP)	26040517	Organics	FlameRetardants					2014-03-13
Bis(2-ethylhexyl)adipate	Bis(2-ethylhexyl)adipate	103231	Organics	SVOCs					2016-05-20
Bis(2-ethylhexyl)phthalate	Bis(2-ethylhexyl)phthalate	117847	Organics	SVOCs	Endocrine Disruptors				2007-07-27
Bis(2-ethylhexyl)phthalate-d4(Surrogate)	Surrogate: Bis(2-ethylhexyl)phthalate-d4	0	Organics	SVOCs					2014-01-29
Bis(2-ethylhexyl)tetrabromophthalate	Bis(2-ethylhexyl)tetrabromophthalate	26040517	Organics	FlameRetardants					2010-01-04
Bis(perfluorohexyl)phosphinate	Bis(perfluorohexyl)phosphinate (6:6 PFPi)	0	Organics	PFAS	PFC Precursor				2014-10-20
Bis(perfluorohexyl)phosphinate-d5(Surrogate)	Surrogate: Bis(perfluorohexyl)phosphinate-d5	0	Organics	PFAS					2014-10-02
Bis(perfluorooctyl)phosphinate	Bis(perfluorooctyl)phosphinate (8:8 PFPi)	0	Organics	PFAS	PFC Precursor				2014-10-20
Bis(perfluorooctyl)phosphinate-d3(Surrogate)	Surrogate: Bis(perfluorooctyl)phosphinate-d3	0	Organics	PFAS					2014-10-02
Bismuth	Bismuth	7440699	Inorganics						2013-05-20
Bisphenol A	Bisphenol A	80057	Organics	PPCPs					2010-04-26
Bisphenol A bis(diphenyl phosphate)	Bisphenol A bis(diphenyl phosphate)	5945335	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol A diglycidyl ether	Bisphenol A diglycidyl ether (BPA-DGE)	16755423	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol A-d14(Surrogate)	Surrogate: Bisphenol A-d14	0	Organics	PPCPs	Bisphenols				2018-04-18
Bisphenol A-d16(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol A-d16	96210876	Organics						2022-07-22
Bisphenol A-d6(Surrogate)	Surrogate: Bisphenol A-d6	0	Organics	PPCPs					2016-03-02
Bisphenol AF	Bisphenol AF	1478611	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol AP	Bisphenol AP	1571751	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol B	Bisphenol B	77407	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol BP	Bisphenol BP	1844015	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol C	Bisphenol C	79970	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol C-dichloride	Bisphenol C-dichloride	14868032	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol E	Bisphenol E	2081085	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol F	Bisphenol F	620928	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol G	Bisphenol G	127548	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol M	Bisphenol M	13595250	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol P	Bisphenol P	2167513	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol PH	Bisphenol PH	24038684	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol S	Bisphenol S	80091	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol TMC	Bisphenol TMC	129188994	Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol Z	Bisphenol Z	843550	Organics	PPCPs	Bisphenols				2017-09-19
Bispyribac Sodium	Bispyribac Sodium	125401925	Organics	Pesticides	Herbicides				2016-10-25
Bivalve CI Mean	Bivalve Condition Index Mean	0	Organics	Inorganics	Metals	Conventionals			2012-10-30
Bivalve CI SE	Bivalve Condition Index Standard Error	0	Organics	Inorganics	Metals	Conventionals			2012-10-30
Blue-Green Algae Phycocyanin	Blue-Green Algae Phycocyanin (BGA-PC)	0	WaterQualityMeasurements						2014-05-07
BOD	Biochemical Oxygen Demand (BOD) - 5 day test	0	Inorganics	Conventionals					2007-07-27
BOD10day	Biochemical Oxygen Demand (BOD) - 10 day test	0	Inorganics	Conventionals					2007-07-27
Bolstar	Bolstar (Sulprofos)	35400432	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Boron	Boron	7440428	Inorganics	Conventionals	Metals	Metalloids			2007-07-27
Boscalid	Boscalid	188425856	Organics	Fungicides					2016-05-20
Boscalid-5-hydroxy	5-Hydroxy-Boscalid	661463872	Organics						2022-12-22
Bottle Cap, Metal	Bottle Cap, Metal	0	Debris	Trash	Non-Plastics	Metals			2014-11-04
Bottle Cap, Plastic	Bottle Cap, Plastic	0	Debris	Trash	Plastics	FoodService			2014-11-04
Bottle, Beach	Bottle, Beach	0	Debris	Trash	Plastics	Toxic			2014-11-04
Bottle, Cleaning	Bottle, Cleaning	0	Debris	Trash	Plastics	Toxic			2014-11-04
Bottle, Glass	Bottle, Glass	0	Debris	Trash	Non-Plastics	Household			2014-11-04
Bottle, Plastic	Bottle, Plastic Beverage	0	Debris	Trash	Plastics				2022-11-02
Bottle, Shampoo	Bottle, Shampoo	0	Debris	Trash	Plastics	Household			2014-11-04
Bottle, Soda	Bottle, Soda	0	Debris	Trash	Plastics	FoodService			2014-11-04
Bottle, Sport	Bottle, Sport	0	Debris	Trash	Plastics	FoodService			2014-11-04
Bottle, Water	Bottle, Water	0	Debris	Trash	Plastics	FoodService			2014-11-04
Boulder	Boulder	0	Inorganics	Conventionals	GrainSize				2011-09-08
Brick	Brick	0	Debris	Trash	Non-Plastics	Construction			2014-11-04
Bridge	Bridge	0	Habitat	Debris					2014-11-04
Bridge Fence	Bridge Fence	0	Habitat	Debris					2014-11-04
Bridge Fence Height	Bridge Fence Height	0	Habitat	Debris					2014-11-04
Bridges, Culverts	Bridges, Culverts	0	Habitat						2009-08-20
Broflanilide	Broflanilide	1207727045	Organics	PFAS					2022-11-03
Bromacil	Bromacil	314409	Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Bromate	Bromate	15541454	Inorganics	Conventionals	Nutrients				2013-05-28
Bromide	Bromide	24959679	Inorganics	Conventionals	Nutrients				2013-05-28
Bromo-2-Nitrobenzene, 1-	1-Bromo-2-Nitrobenzene	577195	Organics	VOCs					2019-07-09
Bromo-2-Nitrobenzene, 1-(Surrogate)	Surrogate: 1-Bromo-2-Nitrobenzene	0	Organics	VOCs					2019-07-24
Bromo-3,5-dimethylphenyl-N-methylcarbamate, 4-(Surrogate)	Surrogate: 4-Bromo-3,5-dimethylphenyl-N-methylcarbamate (BDMC)	672991	Organics	OrganochlorinePesticides					2016-03-02
Bromobenzene	Bromobenzene (Phenyl Bromide)	108861	Organics	VOCs					2013-05-28
Bromochloromethane	Bromochloromethane	74975	Organics	VOCs					2007-07-27
Bromodichloromethane	Bromodichloromethane (Dichlorobromomethane)	75274	Organics	VOCs					2011-05-03
Bromofluorobenzene, 4-	4-Bromofluorobenzene	460004	Organics	VOCs					2016-05-20
Bromofluorobenzene, 4-(Surrogate)	Surrogate: 4-Bromofluorobenzene	460004	Organics	VOCs					2016-03-02
Bromoform	Bromoform (Tribromomethane)	75252	Organics	VOCs					2007-07-27
Bromomethane	Bromomethane (Methyl Bromide)	74839	Organics	VOCs					2013-05-28
Bromophenyl Phenyl Ether, 4-	4-Bromophenyl Phenyl Ether	101553	Organics	SVOCs					2013-05-28
Bromophenyl Phenyl Ether, 4-(Surrogate)	Surrogate: 4-Bromophenyl Phenyl Ether	0	Organics	SVOCs					2016-05-20
Bromuconazole	Bromuconazole (Bromoconazole)	116255482	Organics	Pesticides	Fungicides				2023-02-02
Bufencarb	Bufencarb	0	Organics	Pesticides	Insecticides				2017-04-04
Bulk Density	Bulk Density	0	WaterQualityMeasurements	Ancillary					2014-02-05
Burial	Burial	0	Toxicity						2007-07-27
Burns Extent	Burns Extent	0	Habitat						2019-05-07
Burns Intensity	Burns Intensity	0	Habitat						2019-05-07
Burns Proximity	Burns Proximity	0	Habitat						2019-05-07
Butachlor	Butachlor	23184669	Organics	Herbicides					2007-07-27
Butalbital	Butalbital	77269							2021-05-07
Butanone, 2-	2-Butanone (Methyl Ethyl Ketone)	78933	Organics	VOCs					2013-05-28
Butralin	Butralin	33629479	Organics	Pesticides	Herbicides				2016-03-10
Butyl Benzyl Phthalate	Butyl Benzyl Phthalate	85687	Organics	SVOCs	Endocrine Disruptors				2013-05-28
Butyl Benzyl Phthalate-d4(Surrogate)	Surrogate: Butyl Benzyl Phthalate-d4	0	Organics	SVOCs					2014-01-29
Butylate	Butylate	2008415	Organics	Pesticides	Pest-Carbamates				2007-07-27
Butylbenzene, n-	n-Butylbenzene	104518	Organics	VOCs					2007-07-27
Butylbenzene, sec-	sec-Butylbenzene	135988	Organics	VOCs					2007-07-27
Butylbenzene, tert-	tert-Butylbenzene	98066	Organics	VOCs					2007-07-27
Butylhydroxytoluene-d21(Surrogate)	Surrogate: Butylhydroxytoluene-d21 (BHT-d21)	64502994							2022-05-24
Butyl-N-ethyl-2,6-dinitro-4-(trifluoromethyl)aniline, N-	N-Butyl-N-ethyl-2,6-dinitro-4-(trifluoromethyl)aniline (Benfluralin)	0	Organics	Pesticides	Herbicides				2017-04-04
Butylparaben	Butylparaben	94268							2021-05-07
Butyltin as Sn	Butyltin as Sn	0	Organics	Organotins					2016-05-20
C. coli		0							2018-02-13
C. jejuni		0							2018-02-13
Cadmium	Cadmium	7440439	Inorganics	TraceElements	Metals				2007-07-27
Caffeine	Caffeine	58082	Organics	PPCPs					2009-09-29
Caffeine-13C(Surrogate)	Surrogate: Caffeine-13C	202282982	Organics	PPCPs					2013-05-28
Caffeine-13C3(Surrogate)	Surrogate: Caffeine-13C3	0	Organics	PPCPs					2010-04-26
CAFOs Extent	CAFOs Extent	0	Habitat						2019-05-07
CAFOs Intensity	CAFOs Intensity	0	Habitat						2019-05-07
CAFOs Proximity	CAFOs Proximity	0	Habitat						2019-05-07
Calcium	Calcium	7440702	Inorganics	Conventionals	Metals		Constituents		2007-07-27
Calcium bis(methylarsonate)	Calcium bis(methylarsonate)	5902954	Organics	Pesticides					2017-04-20
Calcium Bound Phosphorus	Calcium Bound Phosphorus	0	Inorganics	Conventional	Nutrients				2022-03-01
Camphor	Camphor	76222	Organics						2018-07-16
Campylobacter	Campylobacter	0	Microbiological	Pathogens					2016-05-20
Canopy Cover	Canopy Cover	0	Habitat						2016-09-06
Captafol	Captafol	2425061	Organics	Pesticides	Fungicides				2016-10-25
Captan	Captan	133062	Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
Carbadox	Carbadox	6804075	Organics	PPCPs					2012-05-22
Carbamazepine	Carbamazepine	298464	Organics	PPCPs					2012-05-22
Carbamazepine(Surrogate)	Surrogate: Carbamazepine	0	Organics						2017-03-06
Carbamazepine-d10(Surrogate)	Surrogate: Carbamazepine-d10	0	Organics	PPCPs					2018-01-18
Carbaryl	Carbaryl	63252	Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
Carbazole	Carbazole	86748	Organics	SVOCs					2007-07-27
Carbazole(Surrogate)	Surrogate: Carbazole	86748	Organics	Semi-VOAs					2011-10-13
Carbendazim	Carbendazim	10605217	Organics	Pesticides	Fungicides				2016-03-10
Carbofuran	Carbofuran	1563662	Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
Carbofuran Phenol	Carbofuran Phenol	0	Organics	Pesticides					2017-04-04
Carbon dioxide, free	Carbon dioxide, free	124389							2017-04-28
Carbon Dioxide, total	Carbon Dioxide, total	124389							2017-04-28
Carbon Disulfide	Carbon Disulfide	0	Inorganics	Conventionals					2016-05-20
Carbon Tetrachloride	Carbon Tetrachloride	56235	Organics	VOCs					2013-05-28
Carbon, Total	Total Carbon	7440440	Inorganics	Conventionals					2013-05-20
Carbon-13	Carbon-13	14762744	Organics	Radiochemistry					2014-11-05
Carbon-13/Carbon-12 Ratio	Carbon-13/Carbon-12 Ratio	14762744	Radiochemistry						2013-06-03
Carbon-14	Carbon-14	14762755	Radiochemistry						2013-06-06
Carbon-14 Counting Error	Carbon-14 Counting Error	0	Inorganics						2013-06-06
Carbonate	Carbonate	3812326	Inorganics	Conventionals					2012-09-13
Carbonate Alkalinity as CaCO3	Carbonate Alkalinity as CaCO3	471341	Inorganics	Conventionals	WaterQualityMeasurements				1900-01-01
Carbophenothion	Carbophenothion (Trithion)	786196	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Carbophenothion-Methyl	Carbophenothion-Methyl	0	Organics	Pesticides	Insecticides				2017-04-04
Carboxin	Carboxin (6-methyl-N-phenyl-2,3-dihydro-1,4-oxathiine-5-carboxamide)	0							2017-01-12
Carfentrazone Ethyl	Carfentrazone Ethyl	128639021	Organics	Pesticides					2013-06-27
Carisoprodol	Carisoprodol	78444							2021-05-07
Cascade/Falls	Cascade/Falls	0	Habitat						2009-08-20
Catellicoccus, Gull (Gull2)	Gull Catellicoccus marimammalium, Assay name: Gull2, 5'-TGCATCGACCTAAAGTTTTGAG-3', 5'-GTCAAAGAGCGAGCAGTTACTA-3'	0	Microbiological						2023-01-27
Cattle Grazing Intensity	Cattle Grazing Intensity	0	Habitat						2019-05-07
Cattle GrazingExtent	Cattle GrazingExtent	0	Habitat						2019-05-07
Cattle GrazingProximity	Cattle GrazingProximity	0	Habitat						2019-05-07
CBOD5	Carbonaceous Biological Oxygen Demand (CBOD) - 5 day test	0	WaterQualityMeasurements	Conventionals					2018-01-18
CD/DVD	CD/DVD	0	Debris	Trash	Plastics	Household			2014-11-04
CDOM	Colored Dissolved Organic Matter	0	Habitat						2013-12-18
Cefotaxime	Cefotaxime	63527526	Organics	PPCPs					2010-04-26
Celestolide	Celestolide	0	Organics	Pesticides					2008-06-27
Cellulose Acetate Fiber	Cellulose acetate Fiber	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Cellulose Acetate Fiber Bundle	Cellulose acetate Fiber Bundle	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Cellulose Acetate Film	Cellulose acetate Film	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Cellulose Acetate Fragment	Cellulose acetate Fragment	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Cellulose Acetate Sphere	Cellulose acetate Sphere	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Cellulosic Fiber	Cellulosic Fiber	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Cellulosic Fiber Bundle	Cellulosic Fiber Bundle	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Cellulosic Film	Cellulosic Film	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Cellulosic Foam	Cellulosic Foam	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Cellulosic Fragment	Cellulosic Fragment	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Ceramic Pot/Shard	Ceramic Pot/Shard	0	Debris	Trash	Non-Plastics	Household			2014-11-04
Cerium	Cerium	7440451	Inorganics						2013-05-20
Cesium	Cesium	7440462	Inorganics	Metals					2009-08-05
Chamber biomass	Chamber biomass	0	Toxicity						2007-07-27
Channel Constraining Feature	Channel Constraining Feature	0	Habitat						2009-08-20
Channel Constraint	Channel Constraint	0	Habitat						2009-08-20
Channel Engineered	Channel has been modified/engineered	0	Habitat	FieldObservations					2016-03-02
Channel Grasses	Channel Grasses	0	Habitat						2019-05-07
Channel Margin in Contact	Channel Margin in Contact	0	Habitat						2009-08-20
Channel NonWoody Veg	Channel NonWoody Veg	0	Habitat						2019-05-07
Channel Pattern	Channel Pattern	0	Habitat						2009-08-20
Channel Unit	Channel Unit	0	Habitat						2009-08-20
Channel Width Reach	Channel width used to define reach	0	Habitat						2009-10-29
Channel Woody Veg	Channel Woody Veg	0	Habitat						2019-05-07
Channelization	Channelization	0	Habitat						2009-08-20
Chemical Concentration	Chemical Concentration	0	Toxicity						2013-05-28
Chemical Group A	Total of (Aldrin,Dieldrin,Endrin,Heptachlor,Heptachlor Epoxide,Chlorine,HCH, Endosulfan,Toxaphene)	0	Organics	Pesticides					2014-01-28
Chemical Group B	Total of (1,2-Dichloropropane, 1,3-Dichloropropene and related C3 Compounds)	0	Organics	Pesticides					2017-04-20
Chemical Treatment	Chemical Treatment	0	Habitat						2009-08-20
Chloramben	Chloramben	133904	Organics	Herbicides					2016-05-20
Chloramben, ammonium salt	Chloramben, ammonium salt	1076466	Organics	Pesticides					2017-04-10
Chloramphenicol	Chloramphenicol	56757							2021-05-07
Chlorantraniliprole	Chlorantraniliprole	500008457	Organics	Pesticides	Insecticides				2016-03-10
Chlorate	Chlorate	14866683	Inorganics	Conventionals	Nutrients				2013-05-28
Chlorbenside	Chlorbenside	0	Organics	Pesticides					2008-11-07
Chlordane	Chlordane, not otherwise specified	57749	Organics	Pesticides	Pest-OCHs				2007-12-14
Chlordane, cis-	cis-Chlordane (alpha-Chlordane)	5103719	Organics	Pesticides	Pest-OCHs	Insecticides			2013-05-28
Chlordane, cis-(Surrogate)	Surrogate: cis-Chlordane (alpha-Chlordane)	5103719	Organics	Pesticides					2013-05-27
Chlordane, Technical	Chlordane, mixture of many related chemicals, of which 10 are major components	12789036	Organics	Pesticides	Pest-OCHs				2007-07-27
Chlordane, Total	Total Chlordane, sum of cis-chlordane and trans-chlordane	0							2019-06-11
Chlordane, trans-	trans-Chlordane (gamma-Chlordane)	5103742	Organics	Pesticides	Pest-OCHs	Insecticides			2013-05-28
Chlordane, trans-(Surrogate)	Surrogate: trans-Chlordane (gamma-Chlordane)	0	Organics	Pesticides					2013-05-27
Chlordene	Chlordene	3734483	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2007-07-27
Chlordene Plus	Chlordene Plus (CP)	0	Organics	FlameRetardants					2014-03-13
Chlordene, cis-	cis-Chlordene (alpha-Chlordene)	56534022	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2013-05-28
Chlordene, trans-	trans-Chlordene (gamma-Chlordene)	56641384	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2013-05-28
Chlorfenac	Chlorfenac (Fenac)	85347	Organics	Pesticides	Herbicides				2017-04-20
Chlorfenapyr	Chlorfenapyr	122453730	Organics	Pesticides					2016-10-25
Chlorfenvinphos	Chlorfenvinphos	470906	Organics	Pesticides	Pest-OPs				2007-07-27
Chloride	Chloride	16887006	Inorganics	Conventionals	Nutrients		Constituents		2007-07-27
Chlorimuron Ethyl	Chlorimuron Ethyl	90982324	Organics	SVOCs					2013-05-20
Chlorine, Free	Free Chlorine	0	WaterQualityMeasurements	Ancillary					2014-02-05
Chlorine, Total Residual	Total Residual Chlorine	0	WaterQualityMeasurements						2007-07-27
Chlorite	Chlorite	14998277	Inorganics	Conventionals	Nutrients				2013-05-28
Chlormefos	Chlormefos	0							2019-12-28
Chloro-2-methylphenol, 4-	4-Chloro-2-methylphenol	1570645	Organics	Pesticides					2017-04-20
Chloro-2-methylphenoxy) Butanoic Acid Sodium Salt, 4-(4-	4-(4-Chloro-2-methylphenoxy) Butanoic Acid sodium salt (MCPB, sodium salt)	6062266	Organics	Pesticides					2017-04-10
Chloro-2-methylphenoxy) Butanoic Acid, 4-(4-	4-(4-Chloro-2-methylphenoxy) Butanoic Acid (MCPB)	94815	Organics	SVOCs					2013-05-20
Chloro-3-methylphenol, 4-	4-Chloro-3-methylphenol	59507	Organics	SVOCs	Phenols	Chlorinated Phenols			2007-07-27
Chloro-3-methylphenol, 4-(Surrogate)	Surrogate: 4-Chloro-3-methylphenol	0	Organics	SVOCs					2016-05-20
Chloro-4-isopropylamine-6-amino-s-triazine, 2-	2-Chloro-4-isopropylamine-6-amino-s-triazine (CIAT)	0	Organics	Pesticides					2017-04-04
Chloroallyl alcohol, total	Total Chloroallyl alcohol	0	Organics	Pesticides					2017-04-10
Chloroaniline, 4-	4-Chloroaniline	106478	Organics	SVOCs					2007-07-27
Chlorobenzene	Chlorobenzene	108907	Organics	VOCs					2007-07-27
Chlorobenzene-d5(Surrogate)	Surrogate: Chlorobenzene-d5	3114554	Organics	VOCs					2016-03-02
Chlorobenzilate	Chlorobenzilate	510156	Organics	Pesticides					2016-10-25
Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid, 11-	11-Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid	763051929	Organics	PFAS					2019-08-28
Chloroethane	Chlorethane (Ethyl Chloride)	75003	Organics	VOCs					2013-05-28
Chloroethyl Vinyl Ether, 2	2-Chloroethyl Vinyl Ether	0	Organics	SVOCs					2016-05-20
Chloroethyl Vinyl Ether, 2-	2-Chloroethyl Vinyl Ether	110758	Organics	VOCs					2013-05-28
Chloroethyl Vinyl Ether, 2-(Surrogate)	Surrogate: 2-Chloroethyl Vinyl Ether	0	Organics	SVOCs					2016-05-20
Chloroform	Chloroform	67663	Organics	VOCs	Insecticides				2007-07-27
Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid, 9-	9-Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid	756426581	Organics	PFAS					2019-08-28
Chloromethane	Chloromethane (Methyl Chloride)	74873	Organics	VOCs					2013-05-28
Chloro-N-(2,6-diethylphenyl) acetamide, 2-	2-chloro-N-(2,6-diethylphenyl) acetamide	6967299	Organics	Pesticides					2017-04-10
Chloro-N-(ethoxymethyl)-N-(2-ethyl-6-methylphenyl)acetamide, 2-	2-Chloro-N-(ethoxymethyl)-N-(2-ethyl-6-methylphenyl)acetamide (Acetochlor)	0	Organics	Pesticides	Herbicides				2017-04-04
Chloronaphthalene, 2-	2-Chloronaphthalene	91587	Organics	SVOCs					2007-07-27
Chloronaphthalene, 2-(Surrogate)	Surrogate: 2-Chloronaphthalene	0	Organics	SVOCs					2016-05-20
Chloroneb	Chloroneb	0	Organics	Pesticides	Fungicides				2017-04-04
Chloroneb(Surrogate)	Surrogate: Chloroneb	2675776	Organics	Pesticides	Pest-OCHs	Fungicides			2010-05-02
Chloronicotinic acid, 6-	6-Chloronicotinic acid	5326238	Organics	Pesticides	Insecticides	Neonics			2017-10-05
Chlorophenol, 2-	2-Chlorophenol	95578	Organics	SVOCs	Phenols	Chlorinated Phenols			2007-07-27
Chlorophenol, 2-(Surrogate)	Surrogate: 2-Chlorophenol	0	Organics	SVOCs					2016-05-20
Chlorophenol-d4, 2- (Surrogate)	2-Chlorophenol-d4 (Surrogate)	93951736							2017-01-12
Chlorophenyl Phenyl Ether, 4-	4-Chlorophenyl Phenyl Ether	7005723	Organics	SVOCs					2013-05-28
Chlorophenyl Phenyl Ether, 4-(Surrogate)	Surrogate: 4-Chlorophenyl Phenyl Ether	0	Organics	SVOCs					2016-05-20
Chlorophenyl)-N'-methylurea, N-(4-	N-(4-Chlorophenyl)-N'-methylurea	5352885	Organics	Herbicides					2013-05-20
Chlorophyll a	Chlorophyll a	479618	Inorganics	Conventionals	Benthic	WaterQualityMeasurements			2011-11-10
Chlorophyll a & b	Chlorophyll a & b	0	Inorganics	Conventionals					2016-05-20
Chlorophyll b	Chlorophyll b	0	Inorganics	Conventionals					2016-05-20
Chlorophyll c	Chlorophyll c	0	WaterQualityMeasurements						2018-01-16
Chlorophyll, Total	Total Chlorophyll	0	WaterQualityMeasurements						2011-05-03
ChlorophyllSampleVolume	Volume of material and liquid filtered to produce the chlorophyll a sample	0	Habitat						2009-10-29
Chloropicrin	Chloropicrin	0	Organics	Pesticides					2017-04-04
Chloropropylate	Chloropropylate	0	Organics	Pesticides	Insecticides				2017-04-04
Chloro-p-toluidine hydrochloride, 3-	3-chloro-p-toluidine hydrochloride	7745893	Organics	Pesticides					2017-04-10
Chlorothalonil	Chlorothalonil	1897456	Organics	Pesticides	Pest-OCHs	Algaecides			2007-07-27
Chlorotoluene, 2-	2-Chlorotoluene	95498	Organics	VOCs					2007-07-27
Chlorotoluene, 4-	4-Chlorotoluene	106434	Organics	VOCs					2007-07-27
Chlorotoluron	Chlorotoluron	15545489							2021-05-07
Chloroxuron	Chloroxuron (Chloroxyfenidim) (Norex)	1982474	Organics	Herbicides					2013-05-28
Chloroxuron(Surrogate)	Surrogate: Chloroxuron (Chloroxyfenidim) (Norex)	0	Organics	Pesticides	Herbicides				2017-02-27
Chlorpropham	Chlorpropham	101213	Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Chlorpyrifos	Chlorpyrifos	2921882	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Chlorpyrifos Methyl	Chlorpyrifos Methyl	5598130	Organics	Pesticides	Pest-OPs	Insecticides			2013-05-28
Chlorpyrifos Methyl(Surrogate)	Surrogate: Chlorpyrifos Methyl	5598130	Organics	Pesticides	Pest-OPs	Insecticides			2016-03-02
Chlorpyrifos Methyl/Fenchlorphos	Chlorpyrifos Methyl/Fenchlorphos	0	Organics	Pesticides					2016-05-20
Chlorpyrifos Oxon	Chlorpyrifos Oxon	5598152	Organics	Pesticides	OrganophosphatePest.	Insecticides			2013-05-29
Chlorpyrifos(Surrogate)	Surrogate: Chlorpyrifos	2921882	Organics	Pesticides	OrganophosphatePest.	Insecticides			2013-06-17
Chlorsulfuron	Chlorsulfuron	0	Organics	Pesticides	Herbicides				2017-04-04
Chlortetracycline	Chlortetracycline	57625	Organics	PPCPs					2012-05-22
Chlorthal-Dimethyl, Total	Total Chlorthal-Dimethyl	0	Organics	Pesticides	Herbicides				2017-04-04
Chlorzoxazone	Chlorzoxazone	95250							2021-03-15
Cholesterol	Cholesterol	57885	Organics						2018-07-16
Chromium	Chromium	7440473	Inorganics	TraceElements	Metals				2007-07-27
Chromium III	Chromium III (Trivalent Chromium)	18540300	Metals						2014-01-24
Chromium VI	Chromium VI	18540299	Metals						2011-10-25
Chrysene	Chrysene	218019	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Chrysene/Triphenylene	Chrysene/Triphenylene (CAS #EDF-359)	0	Organics	PAHs					2012-05-22
Chrysene-d12(Surrogate)	Surrogate: Chrysene-d12	1719035	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Chrysenes, C1-	C1-Chrysenes	0	Organics	PAHs	SVOCs	HMW_PAH			2010-06-21
Chrysenes, C2-	C2-Chrysenes	0	Organics	PAHs	SVOCs	HMW_PAH			2010-06-21
Chrysenes, C3-	C3-Chrysenes	0	Organics	PAHs	SVOCs	HMW_PAH			2010-06-21
Chrysenes, C4-	C4-Chrysenes	0	Organics	PAHs					2012-04-04
Cigarette Box/Wrapper	Cigarette Box/Wrapper	0	Debris	Trash	Plastics	Miscellaneous			2014-11-04
Cigarette Butt	Cigarette Butt	0	Debris	Trash	Plastics	Toxic			2014-11-04
Cimetidine	Cimetidine	51481619	Organics	PPCPs					2010-04-26
Cimetidine-d3(Surrogate)	Surrogate: Cimetidine-d3	0	Organics	PPCPs					2016-03-02
Cinerin-1	Cinerin-1	25402066	Organics	Pesticides	Pyrethroids				2011-05-14
Cinerin-2	Cinerin-2 (Cinerin II)	121200	Organics	Pesticides	Pyrethroids				2013-05-27
Ciodrin	Ciodrin (Crotoxyphos)	7700176	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Ciprofloxacin	Ciprofloxacin	85721331	Organics	PPCPs					2010-04-26
Ciprofloxacin-13C3-N15(Surrogate)	Surrogate: Ciprofloxacin-13C3-N15	0	Organics	PPCPs					2010-04-26
Circumference	Circumference	0	Habitat						2012-09-13
Clarithromycin	Clarithromycin	81103119	Organics	PPCPs					2010-04-26
Clay	Clay	0	Inorganics	Conventionals	GrainSize				2011-09-08
Clinafloxacin	Clinafloxacin	105956998	Organics	PPCPs					2010-04-26
Clofibric acid	Clofibric acid	882097							2021-05-07
Clomazone	Clomazone (Dimethazone)	81777891	Organics	Pesticides	Herbicides				2013-05-30
Clonidine	Clonidine	4205907	Organics	PPCPs					2010-04-26
Clonidine-d4(Surrogate)	Surrogate: Clonidine-d4	0	Organics	PPCPs					2010-04-26
Clostridiales, Human (LACHNO3)	Human Clostridiales, Assay Name: LACHNO3	0							2021-12-14
Clothianidin	Clothianidin	210880925	Pesticides						2012-06-21
Clothianidin-d3(Surrogate)	Surrogate: Clothianidin-d3	0	Organics	Pesticides					2018-08-07
Clothianidin-Desmethyl	Clothianidin-Desmethyl	135018154	Organics						2022-10-28
Clothing, synthetic fabric	Clothing, synthetic fabric	0	Debris	Trash	Plastics	Household			2014-11-04
CloudCover	Cloud cover at the time of sampling	0	Habitat						2012-09-13
Cloxacillin	Cloxacillin	61723	Organics	PPCPs					2010-04-26
Cobalt	Cobalt	7440484	Inorganics	Metals					2007-07-27
Cobble	Cobble	0	Inorganics	Conventionals	GrainSize				2011-09-08
Cocaine	Cocaine	50362	Organics	PPCPs					2010-04-26
Cocaine-d3(Surrogate)	Surrogate: Cocaine-d3	0	Organics	PPCPs					2010-04-26
Cocoons	Cocoons (#)	0	Toxicity						2007-07-27
COD	Chemical Oxygen Demand (COD)	0	Inorganics	Conventionals					2007-07-27
Codeine	Codeine	76573	Organics	PPCPs					2010-04-26
Codeine-d6(Surrogate)	Surrogate: Codeine-d6	0	Organics	PPCPs					2010-04-26
Coliform Ratio	The ratio of fecal/total coliform bacteria exceeds 0.1 and the total coliform bacteria exceeds 1000	0	Microbiological	NULL					2016-05-20
Coliform, Fecal	Fecal Coliform	0	Microbiological	Pathogens	Conventionals				2010-09-29
Coliform, Total	Total Coliform	0	Microbiological	Pathogens	Conventionals				2010-09-29
CollectionDepth	Depth at which sample was collected	0	WaterQualityMeasurements						2013-05-28
Colloid	Colloid	0							2020-03-13
CollSub_PlantDead	Algae collected from dead plant (including wood) substratum	0	Habitat						2012-09-13
CollSub_PlantLive	Algae collected from live plant (including wood) substratum	0	Habitat						2012-09-13
CollSub_Rock	Algae collected from rock (including concrete and consolidated sediment) substratum	0	Habitat						2012-09-13
CollSub_SedSoft	Algae collected from soft sediment substratum	0	Habitat						2012-09-13
Color	Color	0	FieldObservations	Habitat					2009-08-20
Color, True	Color of water from which turbidity has been removed	0	Inorganics	Conventionals					2012-09-13
Commercial	Commercial	0	Habitat						2009-08-20
CompositeVolume	Volume of material and liquid in Composite sample	0	Habitat						2009-10-29
Composition	Composition	0	FieldObservations	Habitat					2009-08-20
Computer	Computer	0	Debris	Trash	Plastics	Non-Plastics			2014-11-04
Concrete/Asphalt	Concrete/Asphalt	0	Debris	Trash	Non-Plastics	Construction			2014-11-04
Condom	Condom	0	Debris	Trash	Plastics				2022-11-02
Construction	Construction	0	Habitat						2008-04-02
Construction Debris	Construction debris such as brick, wood, sheetrock using Trash Protocol	0	Trash						2011-05-04
Construction Other	Construction Other	0	Debris	Trash	Non-Plastics	Construction			2014-11-04
Construction Wood/Pellets	Construction Wood/Pellets	0	Debris	Trash	Non-Plastics	Large			2014-11-04
Container, Chemical	Container, Chemical	0	Debris	Trash	Plastics	Toxic			2014-11-04
Container, Juice	Container, Juice	0	Debris	Trash	Plastics	FoodService			2014-11-04
Container, Plastic	Container, Plastic	0	Debris	Trash	Plastics				2022-11-02
Container, Storage	Container, Storage	0	Debris	Trash	Plastics	Household			2014-11-04
Container, Styrofoam	Container, Styrofoam	0	Debris	Trash	Plastics	FoodService			2014-11-04
Copper	Copper	7440508	Inorganics	TraceElements	Metals				2007-07-27
Coprostanol, beta-3-	3-beta-Coprostanol	360689	Organics						2018-07-18
Coronene	Coronene	0	Organics	PAHs					2014-01-28
Cotinine	Cotinine	486566	Organics	PPCPs					2010-04-26
Cotinine-d3(Surrogate)	Surrogate: Cotinine-d3	0	Organics	PPCPs					2010-04-26
Cotton fiber	When cotton is obviously the top hit and cellulose is several hits down. Then we can say it is specifically Cotton. For DYED or CLEAR anthropogenic cotton only and should just be called cotton.	0	Microdebris	Anthropogenic	Natural Based	Fiber			2018-04-26
Cotton Fiber Bundle	Cotton Fiber Bundle	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Cotton Film	Cotton Film	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Cotton Foam	Cotton Foam	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Cotton Fragment	Cotton Fragment	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Coumaphos	Coumaphos	56724	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
CPOM	Coarse particulate organic matter	0	Habitat						2009-08-20
Cresyl Diphenyl Phosphate	Cresyl Diphenyl Phosphate	26444495	Organics	FlameRetardants	PhosphateFlameRetardants				2017-09-19
Cropland	Cropland	0	Habitat						2009-08-20
Crops Irrigated Extent	Crops Irrigated Extent	0	Habitat						2019-05-07
Crops Irrigated Intensity	Crops Irrigated Intensity	0	Habitat						2019-05-07
Crops Irrigated Proximity	Crops Irrigated Proximity	0	Habitat						2019-05-07
Crops NonIrrigated Extent	Crops NonIrrigated Extent	0	Habitat						2019-05-07
Crops NonIrrigated Intensity	Crops NonIrrigated Intensity	0	Habitat						2019-05-07
Crops NonIrrigated Proximity	Crops NonIrrigated Proximity	0	Habitat						2019-05-07
Crutomate	Crutomate	0	Organics	Pesticides					2017-04-04
Cryptosporidium	Cryptosporidium	0	Microbiological	Pathogens	Conventionals				2013-05-28
Cryptosporidium Oocysts Fluorescence	Cryptosporidium Oocysts Fluorescence	0	Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Amorphous Structure	Cryptosporidium Oocysts/Amorphous Structure	0	Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/DAPI & DIC Positive	Cryptosporidium Oocysts/DAPI & DIC Positive	0	Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Empty	Cryptosporidium Oocysts/Empty	0	Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Flourescence Antibody	Cryptosporidium Oocysts/Flourescence Antibody	0	Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Internal Structure	Cryptosporidium Oocysts/Internal Structure	0	Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Internal Structure (One)	Cryptosporidium Oocysts/Internal Structure (One)	0	Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Negative	Cryptosporidium Oocysts/Negative	0	Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Positive	Cryptosporidium Oocysts/Positive	0	Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Positive (Internal Staining)	Cryptosporidium Oocysts/Positive (Internal Staining)	0	Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Positive (Stained Nuclei)	Cryptosporidium Oocysts/Positive (Stained Nuclei)	0	Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Total IFA Count	Cryptosporidium Oocysts/Total IFA Count	0	Microbiological	Pathogens					2017-03-27
CSCI	California Stream Condition Index score, calculated as the average of the O/E and pMMI	0	Habitat						2016-06-21
CSCI_CaptureProb_Abedus	Probability of capturing Abedus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Acari	Probability of capturing Acari calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Acentrella	Probability of capturing Acentrella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Acneus	Probability of capturing Acneus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Aeshna_Rhionaeshna	Probability of capturing Aeshna or Rhionaeshna calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Agabinus	Probability of capturing Agabinus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Agabus	Probability of capturing Agabus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Agapetus	Probability of capturing Agapetus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Allocosmoecus	Probability of capturing Allocosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ambrysus	Probability of capturing Ambrysus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ameletus	Probability of capturing Ameletus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ametor	Probability of capturing Ametor calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Amiocentrus	Probability of capturing Amiocentrus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Amphicosmoecus	Probability of capturing Amphicosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ampumixis	Probability of capturing Ampumixis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Anacaena	Probability of capturing Anacaena calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Anagapetus	Probability of capturing Anagapetus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Anax	Probability of capturing Anax calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Anchycteis	Probability of capturing Anchycteis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Antocha	Probability of capturing Antocha calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Apatania	Probability of capturing Apatania calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Archilestes	Probability of capturing Archilestes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Arctopsyche	Probability of capturing Arctopsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Argia	Probability of capturing Argia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Asellidae	Probability of capturing Asellidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Asioplax	Probability of capturing Asioplax calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Astacidae	Probability of capturing Astacidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Atherix	Probability of capturing Atherix calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Atractelmis	Probability of capturing Atractelmis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Atrichopogon	Probability of capturing Atrichopogon calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Attenella	Probability of capturing Attenella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Baetis	Probability of capturing Baetis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Berosus	Probability of capturing Berosus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Bezzia_Palpomyia	Probability of capturing Bezzia or Palpomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Blephariceridae	Probability of capturing Blephariceridae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Brachycentrus	Probability of capturing Brachycentrus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Brechmorhoga	Probability of capturing Brechmorhoga calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Caenis	Probability of capturing Caenis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Calineuria	Probability of capturing Calineuria calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Callibaetis	Probability of capturing Callibaetis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Callicorixa	Probability of capturing Callicorixa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Calliperla	Probability of capturing Calliperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Caloparyphus_Euparyphus	Probability of capturing Caloparyphus or Euparyphus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Calopterygidae	Probability of capturing Calopterygidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Camelobaetidius	Probability of capturing Camelobaetidius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Capniidae	Probability of capturing Capniidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Caudatella	Probability of capturing Caudatella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Centroptilum	Probability of capturing Centroptilum calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ceraclea	Probability of capturing Ceraclea calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ceratopogon	Probability of capturing Ceratopogon calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ceratopsyche_Hydropsyche	Probability of capturing Ceratopsyche or Hydropsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Chelifera_Metachela	Probability of capturing Chelifera or Metachela calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Cheumatopsyche	Probability of capturing Cheumatopsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Chimarra	Probability of capturing Chimarra calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Chironominae	Probability of capturing Chironominae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Choroterpes	Probability of capturing Choroterpes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Chrysops	Probability of capturing Chrysops calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Chyranda	Probability of capturing Chyranda calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Cinygma	Probability of capturing Cinygma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Cinygmula	Probability of capturing Cinygmula calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Claassenia	Probability of capturing Claassenia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Cleptelmis	Probability of capturing Cleptelmis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Clinocera	Probability of capturing Clinocera calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Cloeodes	Probability of capturing Cloeodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Clostoeca	Probability of capturing Clostoeca calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Cordulegaster	Probability of capturing Cordulegaster calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Corduliidae	Probability of capturing Corduliidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Corydalus	Probability of capturing Corydalus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Crangonyx	Probability of capturing Crangonyx calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Cryptochia	Probability of capturing Cryptochia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Cryptolabis	Probability of capturing Cryptolabis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Culicidae	Probability of capturing Culicidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Culicoides	Probability of capturing Culicoides calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Cultus	Probability of capturing Cultus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Cymbiodyta	Probability of capturing Cymbiodyta calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Dasyhelea	Probability of capturing Dasyhelea calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Desmona	Probability of capturing Desmona calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Despaxia	Probability of capturing Despaxia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Deuterophlebia	Probability of capturing Deuterophlebia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Diamesinae	Probability of capturing Diamesinae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Dicosmoecus	Probability of capturing Dicosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Dicranota	Probability of capturing Dicranota calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Diphetor	Probability of capturing Diphetor calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Diplectrona	Probability of capturing Diplectrona calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Diura	Probability of capturing Diura calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Dixa	Probability of capturing Dixa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Dixella	Probability of capturing Dixella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Dolichopodidae	Probability of capturing Dolichopodidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Dolophilodes	Probability of capturing Dolophilodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Doroneuria	Probability of capturing Doroneuria calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Drunella	Probability of capturing Drunella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Dubiraphia	Probability of capturing Dubiraphia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Dysmicohermes	Probability of capturing Dysmicohermes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ecclisomyia	Probability of capturing Ecclisomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ecdyonurus	Probability of capturing Ecdyonurus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Enallagma	Probability of capturing Enallagma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Enochrus	Probability of capturing Enochrus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Epeorus	Probability of capturing Epeorus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ephemerella	Probability of capturing Ephemerella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ephydridae	Probability of capturing Ephydridae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Eubrianax	Probability of capturing Eubrianax calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Eurylophella	Probability of capturing Eurylophella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Fallceon	Probability of capturing Fallceon calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Farula	Probability of capturing Farula calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ferrissia	Probability of capturing Ferrissia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Forcipomyia	Probability of capturing Forcipomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Fossaria	Probability of capturing Fossaria calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Frisonia	Probability of capturing Frisonia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Gammarus	Probability of capturing Gammarus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Glossiphoniidae	Probability of capturing Glossiphoniidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Glossosoma	Probability of capturing Glossosoma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Glutops	Probability of capturing Glutops calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Goera	Probability of capturing Goera calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Gomphus	Probability of capturing Gomphus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Gonomyia	Probability of capturing Gonomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Graptocorixa	Probability of capturing Graptocorixa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Gumaga	Probability of capturing Gumaga calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Gyraulus	Probability of capturing Gyraulus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Gyrinus	Probability of capturing Gyrinus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Haliplus	Probability of capturing Haliplus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Haploperla	Probability of capturing Haploperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hedriodiscus_Odontomyia	Probability of capturing Hedriodiscus or Odontomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Helichus	Probability of capturing Helichus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Helicopsyche	Probability of capturing Helicopsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Helisoma	Probability of capturing Helisoma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Helodon_Prosimulium	Probability of capturing Helodon or Prosimulium calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Helophorus	Probability of capturing Helophorus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hemerodromia	Probability of capturing Hemerodromia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Heptagenia	Probability of capturing Heptagenia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hesperoconopa	Probability of capturing Hesperoconopa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hesperoperla	Probability of capturing Hesperoperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hesperophylax	Probability of capturing Hesperophylax calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Heterelmis	Probability of capturing Heterelmis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Heterlimnius	Probability of capturing Heterlimnius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Heteroplectron	Probability of capturing Heteroplectron calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hexatoma	Probability of capturing Hexatoma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Himalopsyche	Probability of capturing Himalopsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Homoleptohyphes	Probability of capturing Homoleptohyphes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hyalella	Probability of capturing Hyalella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hydatophylax	Probability of capturing Hydatophylax calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hydra	Probability of capturing Hydra calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hydraena	Probability of capturing Hydraena calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hydrobiidae	Probability of capturing Hydrobiidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hydrobius	Probability of capturing Hydrobius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hydrochus	Probability of capturing Hydrochus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hydroporus	Probability of capturing Hydroporus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hydroptila	Probability of capturing Hydroptila calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Hydrotrupes	Probability of capturing Hydrotrupes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ilybius	Probability of capturing Ilybius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ironodes	Probability of capturing Ironodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ischnura	Probability of capturing Ischnura calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Isogenoides	Probability of capturing Isogenoides calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Isonychia	Probability of capturing Isonychia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Isoperla	Probability of capturing Isoperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Juga	Probability of capturing Juga calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Kathroperla	Probability of capturing Kathroperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Kogotus	Probability of capturing Kogotus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Laccobius	Probability of capturing Laccobius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Lara	Probability of capturing Lara calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Lepidostoma	Probability of capturing Lepidostoma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Lestes	Probability of capturing Lestes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Lethocerus	Probability of capturing Lethocerus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Leucotrichia	Probability of capturing Leucotrichia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Leucrocuta	Probability of capturing Leucrocuta calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Libellula	Probability of capturing Libellula calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Limnophila	Probability of capturing Limnophila calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Limonia	Probability of capturing Limonia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Liodessus	Probability of capturing Liodessus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Lymnaea	Probability of capturing Lymnaea calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Malenka	Probability of capturing Malenka calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Marilia	Probability of capturing Marilia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Maruina	Probability of capturing Maruina calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Matriella_Serratella	Probability of capturing Matriella or Serratella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Megarcys	Probability of capturing Megarcys calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Menetus	Probability of capturing Menetus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Meringodixa	Probability of capturing Meringodixa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Micrasema	Probability of capturing Micrasema calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Microcylloepus	Probability of capturing Microcylloepus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Molophilus	Probability of capturing Molophilus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Moselia	Probability of capturing Moselia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Muscidae	Probability of capturing Muscidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Mystacides	Probability of capturing Mystacides calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Namamyia	Probability of capturing Namamyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Narpus	Probability of capturing Narpus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Nectopsyche	Probability of capturing Nectopsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Nematoda	Probability of capturing Nematoda calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Nematomorpha	Probability of capturing Nematomorpha calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Nemotelus	Probability of capturing Nemotelus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Nemoura	Probability of capturing Nemoura calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Neohermes	Probability of capturing Neohermes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Neophylax	Probability of capturing Neophylax calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Neoplasta	Probability of capturing Neoplasta calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Neothremma	Probability of capturing Neothremma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Neotrichia	Probability of capturing Neotrichia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Nerophilus	Probability of capturing Nerophilus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Nixe	Probability of capturing Nixe calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Nothotrichia	Probability of capturing Nothotrichia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ochrotrichia	Probability of capturing Ochrotrichia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ochthebius	Probability of capturing Ochthebius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Octogomphus_specularis	Probability of capturing Octogomphus or specularis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Oecetis	Probability of capturing Oecetis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Oemopteryx	Probability of capturing Oemopteryx calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Oligochaeta	Probability of capturing Oligochaeta calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Oligophlebodes	Probability of capturing Oligophlebodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Onocosmoecus	Probability of capturing Onocosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ophiogomphus	Probability of capturing Ophiogomphus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Optioservus	Probability of capturing Optioservus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ordobrevia	Probability of capturing Ordobrevia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Oreodytes	Probability of capturing Oreodytes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Oreogeton	Probability of capturing Oreogeton calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ormosia	Probability of capturing Ormosia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Orohermes	Probability of capturing Orohermes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Oroperla	Probability of capturing Oroperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Orthocladiinae	Probability of capturing Orthocladiinae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Osobenus	Probability of capturing Osobenus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ostracoda	Probability of capturing Ostracoda calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ostrocada	Probability of capturing Ostrocada calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Oxyethira	Probability of capturing Oxyethira calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Palaeagapetus	Probability of capturing Palaeagapetus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Paltothemis	Probability of capturing Paltothemis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Paraleptophlebia	Probability of capturing Paraleptophlebia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Paraleuctra	Probability of capturing Paraleuctra calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Paraperla	Probability of capturing Paraperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Parapsyche	Probability of capturing Parapsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Parthina	Probability of capturing Parthina calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Pedicia	Probability of capturing Pedicia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Pedomoecus	Probability of capturing Pedomoecus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Peltodytes	Probability of capturing Peltodytes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Pericoma_Telmatoscopus	Probability of capturing Pericoma or Telmatoscopus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Perlinodes	Probability of capturing Perlinodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Perlomyia	Probability of capturing Perlomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Petrophila	Probability of capturing Petrophila calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Physa_Physella	Probability of capturing Physa or Physella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Plumiperla	Probability of capturing Plumiperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Podmosta	Probability of capturing Podmosta calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Podonominae	Probability of capturing Podonominae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Polycentropus	Probability of capturing Polycentropus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Postelichus	Probability of capturing Postelichus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Probezzia	Probability of capturing Probezzia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Procloeon	Probability of capturing Procloeon calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Prodiamesinae	Probability of capturing Prodiamesinae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Progomphus	Probability of capturing Progomphus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Prostoia	Probability of capturing Prostoia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Prostoma	Probability of capturing Prostoma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Protoptila	Probability of capturing Protoptila calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Psephenus	Probability of capturing Psephenus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Pseudolimnophila	Probability of capturing Pseudolimnophila calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Psychoda	Probability of capturing Psychoda calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Psychoglypha	Probability of capturing Psychoglypha calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Psychomyia	Probability of capturing Psychomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Pteronarcella	Probability of capturing Pteronarcella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Pteronarcys	Probability of capturing Pteronarcys calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Ptychopteridae	Probability of capturing Ptychopteridae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Rhabdomastix	Probability of capturing Rhabdomastix calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Rhithrogena	Probability of capturing Rhithrogena calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Rhizelmis	Probability of capturing Rhizelmis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Rhyacophila	Probability of capturing Rhyacophila calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Rickera	Probability of capturing Rickera calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Sanfilippodytes	Probability of capturing Sanfilippodytes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Scirtidae	Probability of capturing Scirtidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Sialis	Probability of capturing Sialis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Sierraperla	Probability of capturing Sierraperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Sigara	Probability of capturing Sigara calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Silvius	Probability of capturing Silvius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Simulium	Probability of capturing Simulium calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Siphlonurus	Probability of capturing Siphlonurus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Skwala	Probability of capturing Skwala calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Soliperla	Probability of capturing Soliperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Soyedina	Probability of capturing Soyedina calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Sphaeriidae	Probability of capturing Sphaeriidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Sphaeromatidae	Probability of capturing Sphaeromatidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Sphaeromias	Probability of capturing Sphaeromias calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Staphylinidae	Probability of capturing Staphylinidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Stenocolus	Probability of capturing Stenocolus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Stictotarsus	Probability of capturing Stictotarsus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Stilobezzia	Probability of capturing Stilobezzia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Stratiomys	Probability of capturing Stratiomys calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Stygobromus	Probability of capturing Stygobromus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Suwallia	Probability of capturing Suwallia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Sweltsa	Probability of capturing Sweltsa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Syrphidae	Probability of capturing Syrphidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Tabanus_Atylotus	Probability of capturing Tabanus or Atylotus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Taenionema	Probability of capturing Taenionema calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Tanypodinae	Probability of capturing Tanypodinae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Thaumaleidae	Probability of capturing Thaumaleidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Timpanoga	Probability of capturing Timpanoga calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Tinodes	Probability of capturing Tinodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Tipula	Probability of capturing Tipula calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Triaenodes	Probability of capturing Triaenodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Trichoclinocera	Probability of capturing Trichoclinocera calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Tricoryhyphes	Probability of capturing Tricoryhyphes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Tricorythodes	Probability of capturing Tricorythodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Triznaka	Probability of capturing Triznaka calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Tropisternus	Probability of capturing Tropisternus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Turbellaria	Probability of capturing Turbellaria calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Uvarus_subtilis	Probability of capturing Uvarus or subtilis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Visoka	Probability of capturing Visoka calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Wiedemannia	Probability of capturing Wiedemannia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Wormaldia	Probability of capturing Wormaldia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Yoraperla	Probability of capturing Yoraperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Yphria	Probability of capturing Yphria calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Zaitzevia	Probability of capturing Zaitzevia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Zapada	Probability of capturing Zapada calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_CaptureProb_Zoniagrion	Probability of capturing Zoniagrion calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_Clinger_PercentTaxa	Observed percent clinger taxa	0	Bioassessment						2021-01-28
CSCI_Clinger_PercentTaxa_predicted	Predicted percent clinger taxa	0	Bioassessment						2021-01-28
CSCI_Clinger_PercentTaxa_score	Score for percent clinger taxa metric	0	Bioassessment						2021-01-28
CSCI_Coleoptera_PercentTaxa	Observed percent Coleoptera taxa	0	Bioassessment						2021-01-28
CSCI_Coleoptera_PercentTaxa_predicted	Predicted percent Coleoptera taxa	0	Bioassessment						2021-01-28
CSCI_Coleoptera_PercentTaxa_score	Score for percent Coleoptera taxa metric	0	Bioassessment						2021-01-28
CSCI_Count	Total number of organisms in the sample. If purge=T, the post-purge number is shown. A minimum number has not been established, but samples with low values should be evaluated with caution.	0	Bioassessment						2017-05-08
CSCI_E	The sum of all capture probabilities greater than 0.5 at a site. Interpreted as the total number of common taxa expected at a site.	0	Bioassessment						2017-05-08
CSCI_EPT_PercentTaxa	Observed percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa	0	Bioassessment						2021-01-28
CSCI_EPT_PercentTaxa_predicted	Predicted percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa	0	Bioassessment						2021-01-28
CSCI_EPT_PercentTaxa_score	Scored percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa	0	Bioassessment						2021-01-28
CSCI_Intolerant_Percent	Observed percent intolerant individuals (CTV<3)	0	Bioassessment						2021-01-28
CSCI_Intolerant_Percent_predicted	Predicted percent intolerant individuals	0	Bioassessment						2021-01-28
CSCI_Intolerant_Percent_score	Score for percent intolerant individuals metric	0	Bioassessment						2021-01-28
CSCI_Mean_O	The number of common taxa (i.e., capture probability greater than 0.5) observed at a site, averaged across iterations.	0	Bioassessment						2017-05-08
CSCI_MMI	The pMMI score, averaged across 20 iterations. A minimum threshold has not been established, but low values should be considered indicative of degradation.	0	Bioassessment						2017-05-08
CSCI_MMI_Percentile	The percentile of the pMMI score, relative to the reference distribution. A minimum threshold has not been established, but low values should be considered indicative of degradation.	0	Bioassessment						2017-05-08
CSCI_Number_of_MMI_Iterations	Number of subsamples used to calculate the pMMI. If the count is less than 500, no subsampling is performed, and this field will show 1. Otherwise, 20 subsamples are performed.	0	Bioassessment						2017-05-08
CSCI_Number_of_OE_Iterations	Number of subsamples used to calculate the O/E. If the total number of unambiguous taxa is less than 500, no subsampling is performed, and this field will show 1. Otherwise, 20 subsamples are performed.	0	Bioassessment						2017-05-08
CSCI_OoverE	O/E, calculated as Mean_O divided by E.	0	Bioassessment						2017-05-08
CSCI_OoverE_Percentile	The percentile of the O/E score, relative to the reference distribution. A minimum threshold has not been established, but low values should be considered indicative of degradation.	0	Bioassessment						2017-05-08
CSCI_Pcnt_Ambiguous_Individuals	Percent of the total number of individuals excluded from O/E calculation. A maximum number has not been established, but samples with high values should be evaluated with caution.	0	Bioassessment						2017-05-08
CSCI_Pcnt_Ambiguous_Taxa	Percent of the total number of FinalIDs excluded from O/E calculation. A maximum number has not been established, but samples with high values should be evaluated with caution.	0	Bioassessment						2017-05-08
CSCI_Percentile	The percentile of CSCI score, relative to the reference distribution	0	Habitat						2016-06-21
CSCI_ProbGroup1	Probability of membership in Group 1 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_ProbGroup10	Probability of membership in Group 10 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_ProbGroup11	Probability of membership in Group 11 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_ProbGroup2	Probability of membership in Group 2 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_ProbGroup3	Probability of membership in Group 3 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_ProbGroup4	Probability of membership in Group 4 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_ProbGroup5	Probability of membership in Group 5 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_ProbGroup6	Probability of membership in Group 6 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_ProbGroup7	Probability of membership in Group 7 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_ProbGroup8	Probability of membership in Group 8 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_ProbGroup9	Probability of membership in Group 9 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						2021-01-28
CSCI_Shredder_Taxa	Observed number of shredder taxa	0	Bioassessment						2021-01-28
CSCI_Shredder_Taxa_predicted	Predicted number of shredder taxa	0	Bioassessment						2021-01-28
CSCI_Shredder_Taxa_score	Score for shredder taxa metric	0	Bioassessment						2021-01-28
CSCI_Taxonomic_Richness	Observed taxonomic richness	0	Bioassessment						2021-01-28
CSCI_Taxonomic_Richness_predicted	Predicted taxonomic richness	0	Bioassessment						2021-01-28
CSCI_Taxonomic_Richness_score	Score for taxonomic richness metric	0	Bioassessment						2021-01-28
Cumylphenol, 4-	4-Cumylphenol	599644	Organics	Phenols					2018-07-16
Cup	Cup	0	Debris	Trash	Plastics	FoodService			2014-11-04
Cup, Styrofoam	Cup, Styrofoam	0	Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Cup, Waxed Paper	Cup, Waxed Paper	0	Debris	Trash	Plastics	Non-Plastics			2014-11-04
Cup/Plate, Plastic	Cups/plates, Plastic	0	Debris	Trash	Plastics				2022-11-02
Cup/Plate, Polystryene Foam	Cup/plate, Polystyrene Foam, e.g., Styrofoam	0	Debris	Trash	Plastics				2022-11-02
Cup/Plate, Waxed Paper	Cup/plate, Waxed Paper	0	Debris	Trash	Non-Plastics				2022-11-02
Cyanazine	Cyanazine	21725462	Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Cyanide	Cyanide	57125	Inorganics	Conventionals					2007-07-27
Cyanobacteria	Potentially toxigenic (PTOX) genera of cyanobacteria	0							2018-12-05
CyanotoxinSampleVolume	Volume of material and liquid in Cyanotoxin sample	0	Habitat						2012-09-13
Cyantraniliprole	Cyantraniliprole	937279544	Organics	Pesticides	Insecticides				2016-03-10
Cyazofamid	Cyazofamid	120116883	Organics	Pesticides	Fungicides				2016-03-10
Cybutryne	Cybutryne	0	Organics	Pesticides	Herbicides				2017-04-04
Cyclaniliprole	Cyclaniliprole	1031756985	Organics						2022-10-28
Cycloate	Cycloate	1134232	Organics	Pesticides	Pest-Carbamates				2013-07-01
Cyfluthrin, beta-	beta-Cyfluthrin	68359375	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2014-05-15
Cyfluthrin, gamma-	gamma-Cyfluthrin	76703623	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2017-09-15
Cyfluthrin, total	Total Cyfluthrin	68359375	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Cyfluthrin-1	Cyfluthrin peak 1	68359375	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Cyfluthrin-2	Cyfluthrin peak 2	68359375	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Cyfluthrin-2/Cyflurthrin-4	Cyfluthrin-2/Cyflurthrin-4	0	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2013-05-28
Cyfluthrin-3	Cyfluthrin peak 3	68359375	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Cyfluthrin-4	Cyfluthrin peak 4	68359375	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Cyhalofop-butyl	Cyhalofop-butyl	122008859	Organics	Pesticides	Herbicides				2016-03-10
Cyhalothrin, gamma-	gamma-Cyhalothrin	76703623	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2014-03-20
Cyhalothrin, lambda-1	lambda-Cyhalothrin, peak 1 or Warrior-1	91465086	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2014-03-19
Cyhalothrin, lambda-2	lambda-Cyhalothrin, peak 2 or Warrior-2	91465086	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2014-03-19
Cyhalothrin, Total	Total Cyhalothrin	0							2022-02-11
Cyhalothrin, Total lambda-	Total lambda-Cyhalothrin, sum peaks 1 & 2	91465086	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2014-03-19
Cyhalothrin-d6, Total lambda-(Surrogate)	Surrogate: Total lambda-Cyhalothrin-d6	0	Organics	Pesticides					2018-03-21
Cylindrospermopsin	Cylindrospermopsin	0	Microbiological	Cyanotoxins					2012-05-22
Cymene, p-	p-Cymene	0	Organics	VOCs					2014-01-28
Cymoxanil	Cymoxanil	57966957	Organics	Pesticides	Fungicides				2016-03-10
Cypermethrin, Total	Total Cypermethrin, sum peaks 1,2,3 & 4	52315078	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2013-05-28
Cypermethrin-1	Cypermethrin peak 1	67375308	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Cypermethrin-13C6(Surrogate)	Surrogate: Cypermethrin-13C6	0	Organics	Pesticides	Insecticides	Pyrethroids			2014-01-29
Cypermethrin-2	Cypermethrin peak 2	65731842	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Cypermethrin-2/Cypermethrin-4	Cypermethrin-2/Cypermethrin-4	0	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2013-05-28
Cypermethrin-3	Cypermethrin peak 3	71697591	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Cypermethrin-4	Cypermethrin peak 4	52315078	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Cyprazine	Cyprazine	0	Organics	Pesticides	Herbicides				2017-04-04
Cyproconazole	Cyproconazole	94361065	Organics	Pesticides	Fungicides				2016-03-10
Cyprodinil	Cyprodinil	121552612	Organics	Pesticides	Fungicides				2016-03-10
d13C_VPDB	Delta 13C, relative to Vienna Pee Dee Belemnite	0	Organics	IsotopicSignature					2015-05-07
d15N_Air-N2	Delta 15N, relative to Atmospheric Nitrogen	0	Organics	IsotopicSignature					2015-05-07
d34S_VCDT	Delta 34S, relative to Vienna Canyon Diablo Troilite	0	Organics	IsotopicSignature					2015-05-07
Dacthal	Dacthal	1861321	Organics	Pesticides	Pest-OCHs				2007-07-27
Dacthal acid metabolites	Dacthal acid metabolites	0	Organics	Pesticides					2017-04-10
Dacthal Monoacid	Dacthal Monoacid	887547	Organics	Pesticides					2017-04-10
Dairies Extent	Dairies Extent	0	Habitat						2019-05-07
Dairies Intensity	Dairies Intensity	0	Habitat						2019-05-07
Dairies Proximity	Dairies Proximity	0	Habitat						2019-05-07
Dam Extent	Dam Extent	0	Habitat						2019-05-07
Dam Intensity	Dam Intensity	0	Habitat						2019-05-07
Dam Proximity	Dam Proximity	0	Habitat						2019-05-07
Dams	Dams	0	Habitat						2009-08-20
Dazomet	Dazomet	0	Organics	Pesticides	Herbicides				2017-04-04
DBCE(Surrogate)	Surrogate: Dibutylchlorendate	1770805	Organics	Pesticides	Pest-OCHs				2007-07-27
DCBP(p,p')	p,p'-Dichlorobenzophenone (DCBP)	90982	Organics	Pesticides	Pest-OCHs				2007-07-27
DDD(o,p')	o,p'-DDD	53190	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
DDD(o,p')(Surrogate)	Surrogate: o,p'-DDD	53190	Organics	Pesticides	OrganochlorinePesticides	Semi-VOAs			2016-03-02
DDD(o,p')/PCB 118	o,p'-DDD/PCB 118	0	Organics	Pesticides/PCBs					2014-01-28
DDD(p,p')	p,p'-DDD	72548	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
DDD(p,p')(Surrogate)	Surrogate: p,p'-DDD	72548	Organics	Pesticides	Pest-OCHs	Insecticides			2016-03-02
DDD-13C(p,p')(Surrogate)	Surrogate: p,p'-DDD-C13	0	Organics	Pesticides					2018-03-04
DDD-d8(p,p')(Surrogate)	Surrogate: p,p'-DDD-d8	0	Organics	Pesticides					2013-05-29
DDE(o,p')	o,p'-DDE	3424826	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
DDE(o,p')(Surrogate)	Surrogate: o,p'-DDE	0	Organics	Pesticides					2010-07-14
DDE(p,p')	p,p'-DDE	72559	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
DDE(p,p')(Surrogate)	Surrogate: p,p'-DDE	0	Organics	Pesticides					2010-07-14
DDE(p,p')/PCB 087	p,p'-DDE/PCB 087	0	Organics	Pesticides/PCBs					2014-01-28
DDE-13C12(p,p')(Surrogate)	Surrogate: DDE-13C12(p,p')	201612502	Organics						2022-10-27
DDMS(p,p')	p,p'-DDMS	0	Organics	Pesticides					2011-08-22
DDMU(p,p')	p,p'-DDMU	1022226	Organics	Pesticides	Pest-OCHs	Insecticides			2011-11-28
DDT(o,p')	o,p'-DDT	789026	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
DDT(o,p')(Surrogate)	Surrogate: o,p'-DDT	0	Organics	Pesticides					2010-07-14
DDT(p,p')	p,p'-DDT	50293	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
DDT(p,p')(Surrogate)	Surrogate: p,p'-DDT	0	Organics	Pesticides					2010-07-14
DDT(p,p')/PCB 187	p,p'-DDT/PCB 187	0	Organics	Pesticides/PCBs					2014-01-28
Dead Domestic Animals	Dead Domestic Animals	0	Debris	Trash	Non-Plastics	Marine Origin			2014-11-04
Deaminated metribuzin (DA)	Deaminated metribuzin (DA)	0	Organics	Pesticides					2017-04-20
Debris Lines/Silt-Laden Vegetation Extent	Debris Lines/Silt-Laden Vegetation Extent	0	Habitat						2019-05-07
Debris Lines/Silt-Laden Vegetation Intensity	Debris Lines/Silt-Laden Vegetation Intensity	0	Habitat						2019-05-07
Debris Lines/Silt-Laden Vegetation Proximity	Debris Lines/Silt-Laden Vegetation Proximity	0	Habitat						2019-05-07
DebrisLandUse_Commercial	DebrisLandUse_Commercial	0	Habitat	Debris					2014-11-04
DebrisLandUse_Industrial	DebrisLandUse_Industrial	0	Habitat	Debris					2014-11-04
DebrisLandUse_LimitedTimeParking	DebrisLandUse_LimitedTimeParking	0	Habitat	Debris					2014-11-04
DebrisLandUse_OpenSpace	DebrisLandUse_OpenSpace	0	Habitat	Debris					2014-11-04
DebrisLandUse_Park	DebrisLandUse_Park	0	Habitat	Debris					2014-11-04
DebrisLandUse_ParkingLot	DebrisLandUse_ParkingLot	0	Habitat	Debris					2014-11-04
DebrisLandUse_Residential	DebrisLandUse_Residential	0	Habitat	Debris					2014-11-04
Decabromodiphenyl Ethane	Decabromodiphenyl Ethane	84852539	Organics	FlameRetardants					2013-05-29
Decabromodiphenylethane	Decabromodiphenylethane (DBDPE)	84852539	Organics	FlameRetardants					2014-03-13
Decafluorobiphenyl(Surrogate)	Surrogate: Decafluorobiphenyl	434902	Organics	PAHs	SVOCs				2016-03-02
Decalin	Decalin	91178	Organics	VOCs					2014-01-28
Decalin, C1-	C1-Decalin	0	Organics	VOCs					2014-01-28
Decalin, C2-	C2-Decalin	0	Organics	VOCs					2014-01-28
Decalin, C3-	C3-Decalin	0	Organics	VOCs					2014-01-28
Decalin, C4-	C4-Decalin	0	Organics	VOCs					2014-01-28
Decamethylcyclopentasiloxane	Decamethylcyclopentasiloxane	541026							2021-05-19
Decane, 2-phenyl-	2-Phenyl-decane	0	Organics	VOCs					2016-05-20
Decane, 3-phenyl-	3-Phenyl-decane	0	Organics	VOCs					2016-05-20
Decane, 4-phenyl-	4-Phenyl-decane	0	Organics	VOCs					2016-05-20
Decane, 5-phenyl-	5-Phenyl-decane	0	Organics	VOCs					2016-05-20
Decane, n-	n-Decane	0	Organics	Alkanes					2014-01-28
Dechlorane 601	Dechlorane 601	0	Organics	FlameRetardants					2014-03-13
Dechlorane 602	Dechlorane 602	31107445	Organics	FlameRetardants					2014-03-13
Dechlorane 603	Dechlorane 603	0	Organics	FlameRetardants					2014-03-13
Dechlorane 604	Dechlorane 604	0	Organics	FlameRetardants					2014-03-13
Dechlorane 604 Component B	Dechlorane 604 Component B	0	Organics	FlameRetardants					2014-03-13
Dechlorane Plus Mono Adduct	Dechlorane Plus Mono Adduct (DPMA)	0	Organics	FlameRetardants					2014-03-13
Dechlorane Plus, anti-	anti-Dechlorane Plus (anti-DP)	13560899	Organics	FlameRetardants					2010-07-15
Dechlorane Plus, syn-	syn-Dechlorane Plus (syn-DP)	13560899	Organics	FlameRetardants					2010-07-15
Dechlorane Plus, Total	Total Dechlorane Plus (DP)	13560899	Organics	FlameRetardants					2014-03-13
Dehydronifedipine	Dehydronifedipine	0	Organics	PPCPs					2010-04-26
Delta 13C	Delta 13C	0	Organics	Statistic					2014-01-28
Delta 15N	Delta 15N	0	Organics	Statistic					2014-01-28
Delta 15N - baseline corrected	Delta 15N - baseline corrected	0	Organics	Statistic					2014-01-28
Deltamethrin	Deltamethrin	52918635	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Deltamethrin/Tralomethrin	Deltamethrin/Tralomethrin	0	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2010-08-18
Deltamethrin-d6, Total(Surrogate)	Surrogate: Total Deltamethrin-d6	0							2021-08-20
Demeton, Total	Total Demeton	0	Organics	Pesticides	Pest-Ops				2010-05-18
Demeton-O	Demeton-O	298033	Organics	Pesticides					2016-05-20
Demeton-s	Demeton-s	126750	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Density	Density of Sample	0	Habitat						2007-07-27
Deposits	Deposits	0	Habitat						2014-04-17
Desethyl-Atrazine	Desethyl-Atrazine	6190654	Organics	Pesticides	Pest-Triazines				2009-01-12
Desethyl-desisopropyl-atrazine	Desethyl-desisopropyl-atrazine	3397624	Organics	Pesticides	Pest-Triazines				2013-05-20
Desisopropyl-Atrazine	Desisopropyl-Atrazine	1007289	Organics	Pesticides	Pest-Triazines				2009-01-12
Desmedipham	Desmedipham	0	Organics	Pesticides	Herbicides				2017-04-04
Desmethyldiltiazem	Desmethyldiltiazem	0	Organics	PPCPs					2010-04-26
Desmethyl-LR	Desmethyl-LR	120011667	Microbiological	Cyanotoxins					2012-05-22
Desmethyl-RR	Desmethyl-RR	0	Microbiological	Cyanotoxins					2012-05-22
Desmetryn	Desmetryn	1014693	Organics	Pesticides	Pest-Triazines				2009-01-12
Desnitro-imidacloprid	Desnitro-imidacloprid	115970177	Organics	Pesticides	Insecticides	Neonics			2017-10-05
Desthio-prothioconazole	Desthio-prothioconazole	178928706	Organics	Pesticides	Fungicides				2016-03-10
Detergent	Detergent	0	FieldObservations						2015-06-26
Deuterium/Hydrogen Ratio	Deuterium/Hydrogen Ratio	7782390	Isotopes						2013-05-20
Di(2-ethylhexyl) phosphate	Di(2-ethylhexyl) phosphate (DEHP)	298077	Organics	FlameRetardants					2014-03-13
Diallate	Diallate (Avadex)	0	Organics	Pesticides	Herbicides				2017-04-04
Diaminochlorotriazine (DACT)	Diaminochlorotriazine (DACT)	0	Organics	Pesticides					2017-04-20
Diazepam	Diazepam	439145	Organics	PPCPs					2010-04-26
Diazepam-d5(Surrogate)	Surrogate: Diazepam-d5	0	Organics	PPCPs					2010-04-26
Diazinon	Diazinon	333415	Organics	Pesticides	Pest-OPs				2007-07-27
Diazinon(Surrogate)	Surrogate: Diazinon	0	Organics	Pesticides	OrganophosphatePest.	OrganochlorinePesticides			2011-04-07
Diazoxon	Diazoxon	962583	Organics	Pesticides	OrganophosphatePest.	OrganochlorinePesticides			2011-07-15
Dibenz(a,h)anthracene	Dibenz(a,h)anthracene	53703	Organics	PAHs	SVOCs	HMW_PAH			2013-05-28
Dibenz(a,h)anthracene, C1-	C1-Dibenz(a,h)anthracene	0	Organics	PAHs					2014-01-28
Dibenz(a,h)anthracene, C2-	C2-Dibenz(a,h)anthracene	0	Organics	PAHs					2014-01-28
Dibenz(a,h)anthracene, C3-	C3-Dibenz(a,h)anthracene	0	Organics	PAHs					2014-01-28
Dibenz(a,h)anthracene-d14(Surrogate)	Surrogate: Dibenz(a,h)anthracene-d14	53703	Organics	PAHs					2016-03-02
Dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene	Dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene	0							2019-04-23
Dibenzofuran	Dibenzofuran	132649	Organics	SVOCs	Insecticides				2007-07-27
Dibenzothiophene	Dibenzothiophene	132650	Organics	PAHs	SVOCs				2007-07-27
Dibenzothiophene-d8(Surrogate)	Surrogate: Dibenzothiophene-d8	33262292	Organics	PAHs	SVOCs				2007-07-27
Dibenzothiophenes, C1-	C1-Dibenzothiophenes	0	Organics	PAHs	SVOCs				2010-06-21
Dibenzothiophenes, C2-	C2-Dibenzothiophenes	0	Organics	PAHs	SVOCs				2010-06-21
Dibenzothiophenes, C3-	C3-Dibenzothiophenes	0	Organics	PAHs	SVOCs				2010-06-21
Dibenzothiophenes, C4-	C4-Dibenzothiophenes	0	Organics	PAHs	Alkylated PAHs				2018-07-24
Dibromo-2,3-dichlorophenyl-hexachloro-norbornene, 4,6-	4,6-Dibromo-2,3-dichlorophenyl-hexachloro-norbornene (Br2Cl2-DEC604)	0	Organics	FlameRetardants					2015-07-16
Dibromo-3-Chloropropane, 1,2-	1,2-Dibromo-3-Chloropropane (DBCP)	96128	Organics	VOCs					2013-05-28
Dibromo-4-(1,2-dibromoethyl)cyclohexane, alpha-1,2-	alpha-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (alpha-DBE-DBCH)	3322938	Organics	FlameRetardants					2015-07-16
Dibromo-4-(1,2-dibromoethyl)cyclohexane, beta-1,2-	beta-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (beta-DBE-DBCH)	3322938	Organics	FlameRetardants					2015-07-16
Dibromo-4-(1,2-dibromoethyl)cyclohexane, gamma-1,2-	gamma-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (gamma-DBE-DBCH)	3322938	Organics	FlameRetardants					2015-07-16
Dibromo-4-Cyanophenyl Octanoate, 2,6-	2,6-Dibromo-4-Cyanophenyl Octanoate	0	Organics	Pesticides	Herbicides				2017-04-04
Dibromo-4-hydroxybenzonitrile, 3,5-	3,5-Dibromo-4-hydroxybenzonitrile (Bromoxynil)	1689845	Organics	SVOCs					2013-05-20
Dibromoaldrin	Dibromoaldrin (DBALD)	0	Organics	FlameRetardants					2015-07-16
Dibromobiphenyl, 4,4'-(Surrogate)	Surrogate: 4,4'-Dibromobiphenyl	92864	Organics						2022-10-27
Dibromochloromethane	Dibromochloromethane	594183	Organics	VOCs					2007-07-27
Dibromoethane, 1,2-	1,2-Dibromoethane	106934	Organics	VOCs	Insecticides				2007-07-27
Dibromofluoromethane	Dibromofluoromethane	0	Organics	VOCs					2016-05-20
Dibromofluoromethane(Surrogate)	Surrogate: Dibromofluoromethane	186857	Organics	VOCs					2007-07-27
Dibromomethane	Dibromomethane	74953	Organics	VOCs					2007-07-27
Dibromooctafluorobiphenyl(Surrogate)	Surrogate: Dibromooctafluorobiphenyl	10386842	Organics	Pesticides	OrganochlorinePesticides				2013-05-30
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)	Surrogate: 4,4'-Dibromooctafluorobiphenyl (DBOFB)	10386842	Organics	Pesticides	Pest-OCHs				2016-03-02
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)DB-608	Surrogate: 4,4?-Dibromooctafluorobiphenyl run on column DB-608	10386842	Organics	Pesticides	Pest-OCHs				2016-03-02
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)HP-5	Surrogate: 4,4?-Dibromooctafluorobiphenyl run on column HP-5	10386842	Organics	Pesticides	Pest-OCHs				2016-03-02
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)	Surrogate: 4-4' Dibromooctafluorobiphenyl (DBOFB)	10386800	Organics	Pesticides	Pest-OCHs				2013-05-28
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)DB-608	Surrogate: 4,4?-dibromooctafluorobiphenyl run on column DB-608	10386800	Organics	Pesticides	Pest-OCHs				2013-05-28
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)HP-5	Surrogate: 4,4?-dibromooctafluorobiphenyl run on column HP-5	10386800	Organics	Pesticides	Pest-OCHs				2013-05-28
Dibromophenyl-hexachloro-norbornene	Dibromophenyl-hexachloro-norbornene (Br2-DEC604)	0	Organics	FlameRetardants					2015-07-16
Dibromopropane, 1,2-(Surrogate)	Surrogate: 1,2-Dibromopropane	78751	Organics						2021-10-19
Dibutyl phosphate	Dibutyl phosphate (DBP)	107664	Organics	FlameRetardants					2014-03-13
Dibutylchlorendate	Dibutylchlorendate	0	Organics	Pesticides					2011-05-11
Dibutylchlorendate(Surrogate)	Surrogate: Dibutylchlorendate (DBCE)	1770805	Organics	Pesticides	Pest-Pyrethroids				2013-05-28
Dibutyltin as Sn	Dibutyltin as Sn (DBT)	683181	Organics	Organotins	Biocide				2010-06-21
Dicamba	Dicamba (2,5-Dichloro-6-methoxybenzoic Acid)	1918009	Organics	Herbicides					2013-05-28
Dicamba, diethanolamine salt	Dicamba, diethanolamine salt	25059783	Organics	Pesticides					2017-04-20
Dicamba, dimethylamine salt	Dicamba, dimethylamine salt	2300665	Organics	Pesticides					2017-04-20
Dichlofenthion	Dichlofenthion	97176	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Dichlofenthion(Surrogate)	Surrogate: Dichlofenthion	97176	Organics	Pesticides					2015-08-21
Dichlone	Dichlone	117806	Organics	Pesticides	Fungicides				2016-10-25
Dichloran	Dichloran (Botran) (Benzenamine, 2,6-dichloro-4-nitro-)	99309	Pyrethroid Pesticides						2015-07-02
Dichloro-2 butene, cis 1,4-	Cis-1,4-dichloro-2 butene	0	Organics						2018-02-13
Dichloro-2 butene, trans 1,4-	Trans-1,4-dichloro-2 butene	110576					Organics		2016-07-29
Dichloroacetate(Surrogate)	Surrogate: Dichloroacetate	79436	Organics	Acids					2016-03-02
Dichloroaniline, 3,4-	3,4-Dichloroaniline	0							2019-01-23
Dichloroaniline, 3,5-	3,5-Dichloroaniline	626437	Organics	Pesticides					2016-03-10
Dichlorobenzenamine, 3,4-	3,4-Dichlorobenzenamine (3,4-DCA)	95761	Pesticides						2013-05-31
Dichlorobenzene, 1,2-	1,2-Dichlorobenzene	95501	Organics	VOCs	SVOCs	Herbicides			2007-07-27
Dichlorobenzene, 1,2-(Surrogate)	Surrogate: 1,2-Dichlorobenzene	0	Organics	VOCs					2016-05-20
Dichlorobenzene, 1,3-	1,3-Dichlorobenzene	541731	Organics	VOCs	SVOCs	Insecticides			2007-07-27
Dichlorobenzene, 1,3-(Surrogate)	Surrogate: 1,3-Dichlorobenzene	0	Organics	VOCs					2016-05-20
Dichlorobenzene, 1,4-	1,4-Dichlorobenzene	106467	Organics	VOCs	SVOCs	Insecticides			2007-07-27
Dichlorobenzene, 1,4-(Surrogate)	Surrogate: 1,4-Dichlorobenzene	0	Organics	VOCs					2016-05-20
Dichlorobenzene-d4, 1,2-	1,2-Dichlorobenzene-d4	2199691	Organics	VOCs					2016-05-20
Dichlorobenzene-d4, 1,2-(Surrogate)	Surrogate: 1,2-Dichlorobenzene-d4	2199691	Organics	VOCs					2016-05-20
Dichlorobenzene-d4, 1,4-(Surrogate)	Surrogate: 1,4-Dichlorobenzene-d4	3855821	Organics	VOCs	SVOCs	Insecticides			2013-05-28
Dichlorobenzidine, 3,3'-	3,3'-Dichlorobenzidine	91941	Organics	Semi-VOAs					2011-05-11
Dichlorobenzidine, 3,3'-(Surrogate)	Surrogate: 3,3'-Dichlorobenzidine	0	Organics	VOCs					2016-05-20
Dichlorobenzoic Acid, 3,5-	3,5-Dichlorobenzoic Acid	51365	Organics	VOCs					2016-05-20
Dichlorobenzoic Acid, 3,5-(Surrogate)	Surrogate: 3,5-Dichlorobenzoic Acid	0	Organics	VOCs					2016-05-20
Dichlorobenzonitrile, 2,6-	2,6-Dichlorobenzonitrile (Dichlobenil)	1194656	Organics	Pesticides	Herbicides				2016-10-25
Dichlorobenzophenone(p,p')	p,p'-Dichlorobenzophenone	0	Organics	Pesticides					2014-01-28
Dichlorodifluoromethane	Dichlorodifluoromethane	75718	Organics	VOCs					2007-07-27
Dichloroethane, 1,1-	1,1-Dichloroethane	75343	Organics	VOCs					2007-07-27
Dichloroethane, 1,2-	1,2-Dichloroethane	107062	Organics	VOCs		Insecticides			2007-07-27
Dichloroethane-d4, 1,2-(Surrogate)	Surrogate: 1,2-Dichloroethane-d4	17060070	Organics	VOCs					2007-07-27
Dichloroethylene, 1,1-	1,1-Dichloroethylene (1,1-Dichloroethene)	75354	Organics	VOCs					2013-05-28
Dichloroethylene, cis 1,2-	cis-1,2-Dichloroethylene (cis-1,2-Dichloroethene)	156592	Organics	VOCs					2013-05-28
Dichloroethylene, Total 1,2-	Total 1,2-Dichloroethylene	0	Organics	VOCs					2017-03-29
Dichloroethylene, trans 1,2-	trans-1,2-Dichloroethylene (trans-1,2-Dichloroethene)	156605	Organics	VOCs					2013-05-28
Dichlorophenol, 2,4-	2,4-Dichlorophenol	120832	Organics	SVOCs	Phenols	Chlorinated Phenols			2007-07-27
Dichlorophenol, 2,4-(Surrogate)	Surrogate: 2,4-Dichlorophenol	0	Organics	VOCs					2016-05-20
Dichlorophenol, 2,6-	2,6-Dichlorophenol	87650	Organics	SVOCs	Phenols	Chlorinated Phenols			2016-08-19
Dichlorophenoxy)propionic acid isooctyl ester, 2-(2,4-	2-(2,4-dichlorophenoxy)propionic acid isooctyl ester	28631358	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid 2-ethylhexyl ester, 2,4-	2,4-Dichlorophenoxyacetic acid 2-ethylhexyl ester (2,4-D 2-ethylexyl ester)	1928434	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid alkanolamine salts, 2,4-	2,4-Dichlorophenoxyaceticc Acid alkanolamine salts (2,4-D alkanolamine salts)	0	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid butoxyethanol ester, 2,4-	2,4-Dichlorophenoxyaceticc Acid butoxyethanol ester (2,4-D Butoxyethyl ester)	1929733	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid butyl ester, 2,4-	2,4-Dichlorophenoxyaceticc Acid butyl ester (2,4-D butyl ester)	94804	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid diethanolamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid diethanolamine salt (2,4-D diethanolamine salt)	5742198	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid diethylamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid diethylamine salt (2,4-D diethylamine salt)	20940378	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid dimethylamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid dimethylamine salt (2,4-D dimethylamine salt)	2008391	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid dodecylamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid dodecylamine salt (2,4-D dodecylamine salt)	2212546	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid isooctyl ester, 2,4-	2,4-Dichlorophenoxyaceticc Acid isooctyl ester (2,4-D isooctyl ester)	25168267	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid Methyl Ester, 2,4-	2,4-Dichlorophenoxyacetic acid Methyl ester (2,4-D 2-Methyl ester)	1928387	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid n,n-dimethyloleyl-linoleyamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid n,n-dimethyloleyl-linoleyamine salt (2,4-D n,n-dimethyloleyl-linoleyamine salt)	55256321	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid n-oleyl-1, 2,4-3-propylenediamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid n-oleyl-1,3-propylenediamine salt (2,4-D n-oleyl-1,3-propylenediamine salt)	2212591	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid octyl ester, 2,4-	2,4-Dichlorophenoxyaceticc Acid octyl ester (2,4-D octyl ester)	1917971	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid propyl ester, 2,4-	2,4-Dichlorophenoxyaceticc Acid propyl ester (2,4-D propyl ester)	1928616	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid propyleneglycolbutylether ester, 2,4-	2,4-Dichlorophenoxyacetic Acid propylene glycol butyl ether ester (2,4-D propylene glycol butyl ether ester)	1320189	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid tetradecylamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid tetradecylamine salt (2,4-D tetradecylamine salt)	28685189	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid triethylamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid triethylamine salt (2,4-D triethylamine salt)	2646788	Organics	Pesticides					2017-04-10
Dichlorophenoxyacetic Acid, 2,3-(Surrogate)	Surrogate: 2,3-Dichlorophenoxyacetic Acid (2,3-D)	2976741	Organics	VOCs					2016-05-20
Dichlorophenoxyacetic Acid, 2,4-	2,4-Dichlorophenoxyacetic Acid (2,4-D)	94757	Organics	Herbicides					2013-05-28
Dichlorophenoxyacetic Acid, 2,4-(Surrogate)	Surrogate: 2,4-Dichlorophenoxyacetic Acid (2,4-D)	94757	Organics	VOCs					2016-05-20
Dichlorophenoxybutyric Acid dimethylamine salt, 4-(2,4-	4-2,4-Dichlorophenoxybutyric Acid dimethylamine salt	2758421	Organics	Pesticides					2017-04-10
Dichlorophenoxybutyric Acid isooctyl ester, 4-(2,4-	4-2,4-Dichlorophenoxybutyric Acid isooctyl ester	1320156	Organics	Pesticides					2017-04-10
Dichlorophenoxybutyric Acid Methyl Ester, 2,4-	2,4-Dichlorophenoxybutyric Acid Methyl Ester (2,4-DB Methyl Ester)	0	Organics	Herbicides					2013-05-20
Dichlorophenoxybutyric Acid, 2,4-	2,4-Dichlorophenoxybutyric Acid (2,4-DB)	94826	Organics	Herbicides					2013-05-28
Dichlorophenoxybutyric Acid, 2,4-(Surrogate)	Surrogate: 2,4-Dichlorophenoxybutyric Acid (2,4-DB)	0	Organics	VOCs					2016-05-20
Dichlorophenyl isocyanate, 3,4-	3,4-Dichlorophenyl isocyanate	102363	Organics						2018-07-16
Dichlorophenyl Urea, 3,4-	3,4-Dichlorophenyl Urea (DCPU)	2327028	Pesticides						2013-05-31
Dichlorophenyl-3-methyl Urea, 3,4-	3,4-Dichlorophenyl-3-methyl Urea (DCPMU)	3567620	Pesticides						2013-05-31
Dichlorophenylacetic Acid, 2,4-	2,4-Dichlorophenylacetic Acid	19719289	Organics	Herbicides					2016-05-20
Dichlorophenylacetic Acid, 2,4- (Surrogate)	Surrogate: 2,4-Dichlorophenylacetic Acid	19719289	Organics	Herbicides					2013-05-28
Dichloroprop	Dichlorprop (2-(2,4-Dichlorophenoxy)propanoic Acid)	120365	Organics	Herbicides					2013-05-28
Dichloroprop, dimethylamine salt	Dichloroprop, dimethylamine salt	2008391	Organics	Pesticides					2017-04-20
Dichloropropane, 1,2-	1,2-Dichloropropane	78875	Organics	VOCs	Insecticides	Nematocides			2007-07-27
Dichloropropane, 1,3-	1,3-Dichloropropane	142289	Organics	VOCs					2007-07-27
Dichloropropane, 2,2-	2,2-Dichloropropane	594207	Organics	VOCs					2007-07-27
Dichloropropene, 1,1-	1,1-Dichloropropene	563586	Organics	VOCs					2007-07-27
Dichloropropene, 1,3-	1,3-Dichloropropene	0							2016-12-23
Dichloropropene, cis 1,3-	cis-1,3-Dichloropropene	10061015	Organics	VOCs					2007-07-27
Dichloropropene, Total 1,3-	Total 1,3-Dichloropropene	0	Organics	VOCs					2016-05-20
Dichloropropene, trans 1,3-	trans-1,3-Dichloropropene	10061026	Organics	VOCs					2007-07-27
Dichloropropionic Acid, 2,2-	2,2-Dichloropropionic Acid (Dalapon)	75990	Organics	Herbicides					2013-05-28
Dichloro-pyridine-2-carboxylic Acid, 3,6-	3,6-Dichloro-pyridine-2-carboxylic Acid (Clopyralid)	1702176	Organics	Herbicides					2013-05-28
Dichlorotrifluoroethane	Dichlorotrifluoroethane (Freon 123)	306832	Organics	VOCs					2017-04-12
Dichlorotrifluoromethane	Dichlorotrifluoromethane	0	Organics	VOCs					2016-01-26
Dichlorprop, butoxyethyl ester	Dichlorprop, butoxyethyl ester	53404312	Organics	Pesticides					2017-04-10
Dichlorvos	Dichlorvos	62737	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Dichrotophos	Dichrotophos	0	Organics	Pesticides					2016-05-20
Diclofenac	Diclofenac (2-(2-(2,6-Dichlorophenylamino)phenyl)acetic Acid)	15307865	Organics	PPCPs					2013-05-27
Diclofop-Methyl	Diclofop-Methyl	0	Organics	Pesticides	Herbicides				2017-04-04
Dicofol	Dicofol	115322	Organics	Pesticides	Pest-OCHs				2007-07-27
Dicrotophos	Dicrotophos	141662	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Di-dechlorinated Dechlorane Plus	Di-dechlorinated Dechlorane Plus (C10-DP)	0	Organics	FlameRetardants					2014-03-13
Dieldrin	Dieldrin	60571	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
Dieldrin(Surrogate)	Surrogate: Dieldrin	0	Organics	Pesticides					2008-11-17
Dienochlor	Dienochlor	0	Organics	Pesticides	Insecticides				2017-04-04
Diesel Fuel	Diesel Fuel	0	Organics						2015-06-25
Diethatyl-Ethyl	Diethatyl-Ethyl	38727558	Organics	Pesticides	Herbicides				2007-07-27
Diethyl Phosphate	Diethyl Phosphate (DEP)	598027	Organics	FlameRetardants					2015-07-16
Diethyl phthalate	Diethyl phthalate	84662	Organics	SVOCs					2007-07-27
Diethyl-3-methyl-benzamide, N,N-	N,N-Diethyl-3-methyl-benzamide	134623	Organics	PPCPs					2010-04-26
Diethyl-3-methyl-benzamide-d7, N,N-(Surrogate)	Surrogate: N,N-Diethyl-3-methyl-benzamide-d7	0	Organics	PPCPs					2016-10-31
Diethylaniline, 2,6-	2,6-Diethylaniline	579668	Organics	Pesticides					2017-04-10
Diethylstilbestrol	Diethylstilbestrol	0	Organics	PPCPs					2014-01-28
Difenoconazole	Difenoconazole	119446683	Organics	Pesticides	Fungicides				2016-03-10
Difenzoquat Methylsulfate	Difenzoquat Methylsulfate	0	Organics	Pesticides	Herbicides				2017-04-04
Diflubenzuron	Diflubenzuron (Difluron)	35367385	Organics	Pesticides					2013-06-27
Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether, 5,6-(Surrogate)	Surrogate: 5,6-Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether	886748330	Organics	PBDEs					2013-05-28
Difluoro-2,2?,3,3?,4,5,5?,6?-Octabromodiphenyl Ether 4?,6-(Surrogate)	Surrogate: 4?,6-Difluoro-2,2?,3,3?,4,5,5?,6?-Octabromodiphenyl Ether	0	Organics	PBDEs					2013-05-28
Difluorobenzene, 1,4-	1,4-Difluorobenzene	0	Organics	VOCs					2016-05-20
Difluorobenzene, 1,4-(Surrogate)	Surrogate: 1,4-Difluorobenzene	540363	Organics	VOCs	Semi-VOAs				2014-01-29
Digoxigenin	Digoxigenin	1672464	Organics	PPCPs					2010-04-26
Digoxin	Digoxin	20830755	Organics	PPCPs					2010-04-26
Diisopropyl Ether	Diisopropyl Ether	108203	Organics	SVOCs					2013-05-20
Dike/Levee Extent	Dike/Levee Extent	0	Habitat						2019-05-07
Dike/Levee Intensity	Dike/Levee Intensity	0	Habitat						2019-05-07
Dike/Levee Proximity	Dike/Levee Proximity	0	Habitat						2019-05-07
Diltiazem	Diltiazem	42399417	Organics	PPCPs					2010-04-26
Dimethoate	Dimethoate	60515	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Dimethomorph	Dimethomorph	110488705	Organics	Pesticides	Fungicides				2016-03-10
Dimethyl phosphate	Dimethyl Phosphate (DMP)	813785	Organics	FlameRetardants					2015-07-16
Dimethyl phthalate	Dimethyl phthalate	131113	Organics	SVOCs					2007-07-27
Dimethyl-2-nitrobenzene, 1,3-	1,3-Dimethyl-2-nitrobenzene	81209	Organics						2011-10-25
Dimethyl-2-nitrobenzene, 1,3-(Surrogate)	Surrogate: 1,3-Dimethyl-2-nitrobenzene (2,6-Dimethylnitrobenzene)	81209	Organics	VOCs					2016-03-02
Dimethylarsinic Acid	Dimethylarsinic Acid	0	Organics	Herbicides					2014-01-28
Dimethylchrysene, 5,9-	5,9-Dimethylchrysene	0	Organics	PAHs					2014-01-28
Dimethyldibenzothiophene, 2,4-	2,4-Dimethyldibenzothiophene	0	Organics	PAHs					2014-01-28
Dimethylfluorene, 1,7-	1,7-Dimethylfluorene	442660	Organics	PAHs	Semi-VOAs				2010-07-08
Dimethylnaphthalene, 1,2-	1,2-Dimethylnaphthalene	573988	Organics	PAHs	Semi-VOAs				2010-07-08
Dimethylnaphthalene, 1,2,6-	1,2,6-Dimethylnaphthalene	0	Organics	VOCs					2016-05-20
Dimethylnaphthalene, 2,6-	2,6-Dimethylnaphthalene	581420	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Dimethylnaphthalene, 2,6-(Surrogate)	Surrogate: 2,6-Dimethylnaphthalene	0	Organics	PAHs					2014-01-28
Dimethylnaphthalene-d12, 2,6-(Surrogate)	Surrogate: 2,6-Dimethylnaphthalene-d12	581420	Organics	PAHs					2016-03-02
Dimethylphenanthrene, 1,5/1,7-	1,5-Dimethylphenanthrene/1,7-Dimethylphenanthrene	0	Organics	PAHs					2014-01-28
Dimethylphenanthrene, 1,7-	1,7-Dimethylphenanthrene	483874	Organics	PAHs					2010-09-23
Dimethylphenanthrene, 1,8-	1,8-Dimethylphenanthrene	0	Organics	PAHs	LMW_PAH				2018-07-24
Dimethylphenanthrene, 2,6-	2,6-Dimethylphenanthrene	0	Organics	PAHs	LMW_PAH				2018-07-24
Dimethylphenanthrene, 3,6-	3,6-Dimethylphenanthrene	1576676	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Dimethylphenol, 2,4-	2,4-Dimethylphenol	105679	Organics	SVOCs	Phenols	non-Chlorinated Phenols			2007-07-27
Dimethylphenol, 2,4-(Surrogate)	Surrogate: 2,4-Dimethylphenol	0	Organics	SVOCs					2016-05-20
Dimethylxanthine, 1,7-	1,7-Dimethylxanthine	611596	Organics	PPCPs					2010-04-26
Di-n-butyl Phthalate	Di-n-butyl Phthalate	84742	Organics	SVOCs	Endocrine Disruptors				2013-05-28
Di-n-butyl Phthalate-d4(Surrogate)	Surrogate: Di-n-butyl Phthalate-d4	0	Organics	SVOCs					2014-01-29
Dinitro-2-methylphenol, 4,6-	4,6-Dinitro-2-methylphenol	534521	Organics	SVOCs	Phenols	non-Chlorinated Phenols			2007-07-27
Dinitro-2-methylphenol, 4,6-(Surrogate)	Surrogate: 4,6-Dinitro-2-methylphenol	0	Organics	SVOCs					2016-05-20
Dinitrophenol, 2,4-	2,4-Dinitrophenol	51285	Organics	SVOCs	Phenols	non-Chlorinated Phenols			2007-07-27
Dinitrophenol, 2,4-(Surrogate)	Surrogate: 2,4-Dinitrophenol	0	Organics	SVOCs					2016-05-20
Dinitrotoluene, 2,4-	2,4-Dinitrotoluene	121142	Organics	SVOCs					2007-07-27
Dinitrotoluene, 2,4-(Surrogate)	Surrogate: 2,4-Dinitrotoluene	0	Organics	SVOCs					2016-05-20
Dinitrotoluene, 2,6-	2,6-Dinitrotoluene	606202	Organics	SVOCs					2007-07-27
Dinitrotoluene, 2,6-(Surrogate)	Surrogate: 2,6-Dinitrotoluene	0	Organics	SVOCs					2016-05-20
Di-n-octyl Phthalate	Di-n-octyl Phthalate	117840	Organics	SVOCs					2013-05-28
Dinoseb	Dinoseb (2,4-Dinitro-6-sec-butylphenol)	88857	Organics	Herbicides					2013-07-01
Dinotefuran	Dinotefuran	165252700	Organics	Pesticides	Insecticides				2016-03-10
Dinotefuran-13C5(Surrogate)	Surrogate: Dinotefuran-13C5	0	Organics	Pesticides					2018-08-07
Di-n-propylnitrosamine	Di-n-propylnitrosamine	0	Organics	SVOCs					2014-01-29
Dioxa-3H-Perfluorononanoate Acid, 4,8-	4,8-Dioxa-3H-Perfluorononanoate Acid	919005144	Organics	PFAS					2019-08-28
Dioxacarb	Dioxacarb (2-(1,3-Dioxolan-2-yl)phenyl Methylcarbamate)	6988212	Organics	Pesticides	Pest-Carbamates	Insecticides			2013-07-01
Dioxane, 1,4-	1,4-Dioxane	0							2016-12-23
Dioxathion	Dioxathion	87342	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Diphenamid	Diphenamid	957517	Organics	Pesticides	Herbicides				2007-07-27
Diphenamid(Surrogate)	Surrogate: Diphenamid	957517	Organics	Pesticides					2016-03-02
Diphenhydramine	Diphenhydramine	58731	Organics	PPCPs					2010-04-26
Diphenyl Ether	Diphenyl Ether	0	Organics	VOCs					2014-02-05
Diphenyl phosphate	Diphenyl phosphate (DPP)	838857	Organics	FlameRetardants					2014-03-13
Diphenylamine	Diphenylamine	122394	Organics	Pesticides					2014-01-28
Diphenylanthracene, 9,10-	9,10-Diphenylanthracene	0							2019-06-11
Diphenylguanidine,1,3-	1,3-diphenylguanidine	102067	Organics	Amidines					2019-12-11
Diphenylhydrazine, 1,2-	1,2-Diphenylhydrazine	0	Organics	PPCPs					2014-01-28
Diphenylhydrazine, 1,2-(Surrogate)	Surrogate: 1,2-Diphenylhydrazine	0	Organics	VOCs					2016-05-20
Diphenylphthalate(Surrogate)	Surrogate: Diphenylphthalate	0	Organics	VOCs					2014-02-05
Dipropetryn	Dipropetryn	4147517	Organics	Pesticides	Pest-Triazines				2009-01-12
Diquat	Diquat	85007	Organics	Pesticides					2008-11-17
Direct Septic/Sewage Discharge Extent	Direct Septic/Sewage Discharge Extent	0	Habitat						2019-05-07
Direct Septic/Sewage Discharge Intensity	Direct Septic/Sewage Discharge Intensity	0	Habitat						2019-05-07
Direct Septic/Sewage Discharge Proximity	Direct Septic/Sewage Discharge Proximity	0	Habitat						2019-05-07
Discharge	Discharge from a calculation	0	WaterQualityMeasurements						2007-07-27
Discharge Direct Measurement	Discharge Direct Measurement	0	WaterQualityMeasurements	Ancillary					2014-02-05
DischargeMeasurementMethod	Method used to collect discharge (velocity) measurement	0	WaterQualityMeasurements						2012-05-22
DischargeMeasurementRating	Code qualifying the stream discharge measurement quality in relation to the actual flow	0	WaterQualityMeasurements						2012-05-22
Disodium methylarsonate	Disodium methylarsonate	144218	Organics	Pesticides					2017-04-20
Dissolved Inorganic Carbon	Dissolved Inorganic Carbon (DIC)	7440440	Inorganics	Conventionals					2016-05-20
Dissolved Organic Carbon	Dissolved Organic Carbon (DOC)	0	Inorganics	Conventionals					2007-07-27
Distance from Bank	Distance from Bank	0	Habitat						2009-08-20
Distance to Bankfull	Distance from the wetted edge to the Bankfull mark	0	Habitat						2012-09-13
Distance, Float	Float distance of observed object	0	Habitat						2009-08-20
Distance, Sampled	Distance sampled within a given waterbody	0	Habitat						2012-09-13
Disulfoton	Disulfoton	298044	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Disulfoton Sulfone	Disulfoton Sulfone	0	Organics	Pesticides					2014-01-28
Ditches/Canals Extent	Ditches/Canals Extent	0	Habitat						2019-05-07
Ditches/Canals Intensity	Ditches/Canals Intensity	0	Habitat						2019-05-07
Ditches/Canals Proximity	Ditches/Canals Proximity	0	Habitat						2019-05-07
Dithiopyr	Dithiopyr	97886458	Organics	Pesticides	Herbicides				2016-03-10
Diuron	Diuron	330541	Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Diuron-d6(Surrogate)	Surrogate: Diuron-d6	1007536675	Organics	Pesticides	Pest-Carbamates	Herbicides			2021-10-19
DMPA	DMPA (O-(2,4-Dichlorophenyl)-O'-Methyl-N-Isopropylphosphoro amido thioate)	299854	Organics	Pesticides					2017-04-20
DNOC, sodium salt	DNOC, Sodium salt (4,6-Dinitro-2-methylphenol sodium salt)	2312767	Organics	Pesticides					2017-04-10
Docohexaenoic Acid	Docohexaenoic Acid	0	Organics	Omega Fatty Acid					2016-05-20
Docosahexaenoic Acid	Docosahexaenoic Acid	6217545	Organics	Omega Fatty Acid					2012-09-12
Docosane, n-	n-Docosane	0	Organics	Alkanes					2014-01-28
Docosapentaenoic Acid	Docosapentaenoic Acid	0	Organics	Omega Fatty Acid					2013-05-28
Dodecamethylcyclohexasiloxane	Dodecamethylcyclohexasiloxane	540976							2021-05-19
Dodecane, 2-phenyl-	2-Phenyl-dodecane	0	Organics	VOCs					2016-05-20
Dodecane, 3-phenyl-	3-Phenyl-dodecane	0	Organics	VOCs					2016-05-20
Dodecane, 4-phenyl-	4-Phenyl-dodecane	0	Organics	VOCs					2016-05-20
Dodecane, 5-phenyl-	5-Phenyl-dodecane	0	Organics	VOCs					2016-05-20
Dodecane, 6-phenyl-	6-Phenyl-dodecane	0	Organics	VOCs					2016-05-20
Dodecane, n-	n-Dodecane	0	Organics	Alkanes					2014-01-28
Dodecylammonium Methanearsonate	Dodecylammonium Methanearsonate	0	Organics	Pesticides	Herbicides				2017-04-04
Dodemorph	Dodemorph	0	Organics	Pesticides	Fungicides				2017-04-04
Dodine	Dodine	0	Organics	Pesticides	Fungicides				2017-04-04
Dominant Benthic Substrate	Dominant Benthic Substrate - Specific to EMAP BA	0	Habitat						2009-08-20
Dominant Land Use	Dominant Land Use	0	Habitat						2009-08-20
DominantSubstrate	DominantSubstrate	0	FieldObservations	Habitat					2009-08-20
Domoic Acid	Domoic Acid	14277975	Microbiological	Cyanotoxins					2013-05-28
Dotriacontane, n-	n-Dotriacontane	544854	Organics	Alkanes					2013-05-01
Doxycycline	Doxycycline	564250	Organics	PPCPs					2012-05-22
Dredging	Dredging	0	Habitat						2009-08-20
Dry	Dry	0	Habitat						2009-08-20
Dry Weight	Dry Weight	0	Tissue	Ancillary					2014-02-05
Dry Weight Standard Error	Dry Weight Standard Error	0	Tissue	Ancillary					2014-02-05
Dumping	Dumping using Trash Protocol	0	Trash						2011-05-04
DW_Algae	Total Dry Weight primarily of Algae but other items may be weighed	0							2020-01-14
E. coli	Escherichia coli	0	Microbiological	Pathogens	Conventionals				2007-07-27
E. Coli O157:H7	Escherichia Coli O157:H7 strain	0	Microbiological	Pathogens	Conventionals				2013-05-28
Eicosane, n-	n-Eicosane	0	Organics	Alkanes					2014-01-28
Eicosapentaenoate	Eicosapentaenoate	0	Organics	Omega Fatty Acid					2012-09-12
ElectricalConductivity	Electrical Conductivity	0	WaterQualityMeasurements	Conventionals					2007-07-27
Elevation Difference	Elevation Difference	0	Habitat						2009-08-20
Embeddedness	Embeddedness	0	Habitat						2009-08-20
Emergent	Emergent (%)	0	Toxicity						2007-07-27
Emergent juvenile	Emergent juvenile (#)	0	Toxicity						2007-07-27
Enalapril	Enalapril	75847733	Organics	PPCPs					2010-04-26
Enalapril-d5(Surrogate)	Surrogate: Enalapril-d5	0	Organics	PPCPs					2010-04-26
End Time	Time (hh:mm) when a given event ended	0	Habitat						2012-09-13
Endosulfan I	Endosulfan I (alpha-Endosulfan)	959988	Organics	Pesticides	Pest-OCHs	Insecticides			2013-05-28
Endosulfan I(Surrogate)	Surrogate: Endosulfan I (alpha-Endosulfan)	0	Organics	Pesticides					2014-01-28
Endosulfan I-d4(Surrogate)	Surrogate: Endosulfan I-d4 (alpha-Endosuflan-d4)	0	Organics	Pesticides					2013-05-27
Endosulfan II	Endosulfan II (beta-Endosulfan)	33213659	Organics	Pesticides	Pest-OCHs	Insecticides			2013-05-28
Endosulfan II(Surrogate)	Surrogate: Endosulfan II (beta-Endosulfan)	0	Organics	Pesticides					2014-01-28
Endosulfan II-d4(Surrogate)	Surrogate: Endosulfan II-d4	0	Organics						2017-03-06
Endosulfan Sulfate	Endosulfan Sulfate	1031078	Organics	Pesticides	Pest-OCHs	Insecticides			2013-05-28
Endosulfan Sulfate-13C9(Surrogate)	Surrogate: Endosulfan Sulfate-13C9	0	Organics	VOCs					2016-05-20
Endothall	Endothall	0	Organics	Pesticides	Herbicides				2017-04-04
Endothall, dipotassium salt	Endothall, dipotassium salt	2164070	Organics	Pesticides					2017-04-10
Endothall, mono (N,N-diethyl alkylamine) salt	Endothall, mono (N,N-diethyl alkylamine) salt	0	Organics	Pesticides					2017-04-10
Endothall, mono (N,N-dimethyl alkylamine) salt	Endothall, mono (N,N-dimethyl alkylamine) salt	0	Organics	Pesticides					2017-04-10
Endrin	Endrin	72208	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
Endrin Aldehyde	Endrin Aldehyde	7421934	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
Endrin Aldehyde(Surrogate)	Surrogate: Endrin Aldehyde	0	Organics	Pesticides	OrganochlorinePesticides	Semi-VOAs			2012-09-07
Endrin Ketone	Endrin Ketone	53494705	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
Endrin Ketone-13C12(IsoDilAnalogue)	Isotopic Dilution Analogue: Endrin Ketone-13C12	0							2022-07-06
Endrin Ketone-13C12(Surrogate)	Surrogate: Endrin Ketone-13C12	53494705	Organics	Pesticides					2013-06-17
Endrin(Surrogate)	Surrogate: Endrin	72208	Organics	Pesticides					2016-03-02
Endrin-13C12(IsoDilAnalogue)	Isotopic Dilution Analogue: Endrin-13C12	0							2022-07-06
Endrin-13C12(Surrogate)	Surrogate: Endrin-13C12	72208	Organics	Pesticides					2016-03-02
Enrofloxacin	Enrofloxacin	93106606	Organics	PPCPs					2010-04-26
Enterococcus	Enterococcus	0	Microbiological	Pathogens	Conventionals				2007-07-27
Enterovirus		0							2018-02-13
Epitestosterone	Epitestosterone	481301							2018-08-31
EPN	EPN	2104645	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
EPN(Surrogate)	Surrogate: EPN	2104645	Organics	Pesticides	OrganophosphatePest.	Semi-VOAs			2013-01-31
EPTC	EPTC	759944	Organics	Pesticides	Herbicides				2007-07-27
EPTC(Surrogate)	Surrogate: EPTC	759944	Organics	Pesticides	Herbicides				2016-03-02
Erythromycin	Erythromycin	114078							2021-05-07
Erythromycin-H2O	Erythromycin-H2O	0	Organics	PPCPs					2012-05-22
Erythromycin-H2O-13C2(Surrogate)	Surrogate: Erythromycin-H2O-13C2	0	Organics	PPCPs					2010-04-26
Esfenvalerate	Esfenvalerate	66230044	Organics	Pesticides					2016-05-20
Esfenvalerate/Fenvalerate, Total	Total Esfenvalerate/Fenvalerate, sum peaks 1 & 2	51630581	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2013-05-28
Esfenvalerate/Fenvalerate-1	Esfenvalerate/Fenvalerate peak 1	51630581	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Esfenvalerate/Fenvalerate-2	Esfenvalerate/Fenvalerate peak 2	66230404	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2007-07-27
Esfenvalerate-d6, Total(Surrogate)	Surrogate: Total Esfenvalerate-d6, sum peaks 1 & 2	0	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2015-06-10
Esfenvalerate-d6-1(Surrogate)	Surrogate: Esfenvalerate-d6 peak 1	0	Organics	Pesticides	Insecticides	Pyrethroids			2012-12-13
Esfenvalerate-d6-2(Surrogate)	Surrogate: Esfenvalerate-d6 peak 2	0	Organics	Pesticides	Insecticides	Pyrethroids			2013-10-29
Estradiol, 17alpha-	17alpha-Estradiol	57910							2018-08-31
Estradiol, 17beta-	17beta-Estradiol	50282	Organics	PPCPs					2013-05-28
Estradiol-d3, 17beta-(IsoDilAnalogue)	Isotope Dilution Analogue: 17beta-Estradiol-d3	79037379	Organics						2022-07-22
Estriol	Estriol	50271							2018-08-31
Estriol-d2(Surrogate)	Surrogate: Estriol-d2	53866323							2022-05-24
Estrone	Estrone	53167	Organics	PPCPs					2012-08-15
Ethaboxam	Ethaboxam	162650773	Organics	Pesticides	Fungicides				2016-03-10
Ethafluralin	Ethalfluralin	55283686	Organics	Pesticides	Herbicides				2013-05-30
Ethalfluralin	Ethalfluralin	55283686	Organics	Pesticides	Herbicides				2007-07-27
Ethanol	Ethanol (Ethyl Alcohol)	0	Organics	Pesticides					2017-04-04
Ethion	Ethion	563122	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Ethion monoxon	Ethion monoxon	17356422	Organics	Pesticides					2017-04-20
Ethion(Surrogate)	Surrogate: Ethion	563122	Organics	Pesticides	OrganophosphatePest.	OrganochlorinePesticides			2016-03-02
Ethofenprox	Ethofenprox	80844071	Organics	PPCPs					2012-09-13
Ethofumesate	Ethofumesate	0	Organics	Pesticides					2017-04-04
Ethoprop	Ethoprop (Prophos)	13194484	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Ethyl Ether	Ethyl Ether	60297	Organics	VOCs					2013-05-20
Ethyl Perfluorooctane Sulfonamido Acetic Acid, N-	N-Ethyl Perfluorooctane Sulfonamido Acetic Acid (Et-PFOSA-AcOH)	0	Organics	PFAS	PFC Precursor				2014-10-20
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5 (N-EtFOSAA)	0	Organics						2022-02-24
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(Surrogate)	Surrogate: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5	0	Organics	PFAS	PFC Precursor				2014-11-03
Ethyl Tert-butyl Ether	Ethyl Tert-butyl Ether (ETBE)	637923	Organics	VOCs					2013-05-28
Ethyl-6-methylaniline, 2-	2-Ethyl-6-methylaniline	24549062	Organics	Pesticides					2017-04-10
Ethylan	Ethylan	0	Organics	Pesticides	Insecticides				2017-04-04
Ethylbenzene	Ethylbenzene	100414	Organics	VOCs	MTBE_BTEX				2007-07-27
Ethylene bis(tetrabromophthalimide)	Ethylene bis(tetrabromophthalimide) (EBTEBPI)	32588764	Organics	FlameRetardants					2014-03-13
Ethylene Glycol	Ethylene Glycol	107211					Organics		2016-10-21
Ethylene Thiourea	Ethylene Thiourea	0	Organics	Pesticides					2017-04-04
Ethylene/vinyl Acetate Co-polymer Fiber	Ethylene/vinyl acetate copolymer Fiber	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Ethylene/vinyl Acetate Co-polymer Film	Ethylene/vinyl acetate copolymer Film	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Ethylene/vinyl Acetate Co-polymer Foam	Ethylene/vinyl acetate copolymer Foam	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Ethylene/vinyl Acetate Co-polymer Fragment	Ethylene/vinyl acetate copolymer Fragment	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Ethylene/vinyl Acetate Co-polymer Sphere	Ethylene/vinyl acetate copolymer Sphere	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Ethylene-propylene copolymer fragment	Ethylene-propylene copolymer fragment that can be grouped under the plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment			2018-06-18
Ethylhexyl 2,3,4,5-tetrabromobenzoate, 2-	2-Ethylhexyl 2,3,4,5-tetrabromobenzoate	183658277	Organics	FlameRetardants					2010-07-15
Ethylparaben	Ethylparaben	120478							2021-05-07
Ethyl-perfluorooctanesulfonamide, N-	N-Ethyl-perfluorooctanesulfonamide	0	Organics	PFAS					2010-02-23
Ethyl-perfluorooctanesulfonamide-d5, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl-perfluorooctanesulfonamide-d5 (N-EtFOSA)	0	Organics						2022-03-04
Ethyl-perfluorooctanesulfonamide-d5, N-(Surrogate)	Surrogate: Ethyl-perfluorooctanesulfonamide-d5, N- (N-EtFOSA)	0	Organics	PFAS					2021-06-02
Ethyl-perfluorooctanesulfonamidoethanol, N-	N-Ethyl-perfluorooctanesulfonamidoethanol	0	Organics	PFAS					2010-02-23
Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl-perfluorooctanesulfonamidoethanol-d9 (N-EtFOSE)	0	Organics						2022-03-04
Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(Surrogate)	Surrogate: Ethyl-perfluorooctanesulfonamidoethanol-d9, N- (N-EtFOSE)	0	Organics	PFAS					2021-06-02
Ethynylestradiol, 17alpha-	17alpha-Ethynylestradiol	57636							2018-08-31
Ethynylestradiol-d4, 17alpha-(IsoDilAnalogue)	Isotope Dilution Analogue: 17alpha-Ethynylestradiol-d4	350820063	Organics						2022-07-22
Ethynylestradiol-d4, 17alpha-(Surrogate)	Surrogate: 17alpha-Ethynylestradiol-d4	350820063							2022-05-24
Etoxazole	Etoxazole	153233911	Organics						2018-07-16
Europium	Europium	7440531	Inorganics						2013-05-20
Ev_FlowHab	Evenness of flow habitat types physical-habitat metric	0	Bioassessment						2021-01-28
Evidence of Fire	Evidence of Fire	0	Habitat						2009-08-20
Evidence of Fire Intensity	Evidence of Fire Intensity - Specific to EMAP BA	0	Habitat						2009-08-27
Evidence of Illegal Connection	Evidence of Illegal Connection	0							2016-06-13
Evidence of Illegal Dumping	Evidence of Illegal Dumping	0							2016-06-13
Evidence of Recent Rainfall	Evidence of Recent Rainfall	0	Habitat						2009-08-20
Evidence of Scour	Site is affected by recent scouring event	0	Habitat	FieldObservations					2016-02-24
E-waste	E-waste	0	Debris	Trash	Plastics	Toxic			2014-11-04
Excavation Extent	Excavation Extent	0	Habitat						2019-05-07
Excavation Intensity	Excavation Intensity	0	Habitat						2019-05-07
Excavation Proximity	Excavation Proximity	0	Habitat						2019-05-07
Excess Animal Waste Extent	Excess Animal Waste Extent	0	Habitat						2019-05-07
Excess Animal Waste Intensity	Excess Animal Waste Intensity	0	Habitat						2019-05-07
Excess Animal Waste Proximity	Excess Animal Waste Proximity	0	Habitat						2019-05-07
Excess Sediment Input Other Extent	Excess Sediment Input Other Extent	0	Habitat						2019-05-07
Excess Sediment Input Other Intensity	Excess Sediment Input Other Intensity	0	Habitat						2019-05-07
Excess Sediment Input Other Proximity	Excess Sediment Input Other Proximity	0	Habitat						2019-05-07
Excessive Human Visitation Extent	Excessive Human Visitation Extent	0	Habitat						2019-05-07
Excessive Human Visitation Intensity	Excessive Human Visitation Intensity	0	Habitat						2019-05-07
Excessive Human Visitation Proximity	Excessive Human Visitation Proximity	0	Habitat						2019-05-07
Fabric	Fabric	0	Debris	Trash	Non-Plastics	Biodegradable			2014-11-04
FabricCloth	Fabric Cloth using Trash Protocol	0	Trash						2011-05-04
Fallow Fields Extent	Fallow Fields Extent	0	Habitat						2019-05-07
Fallow Fields Intensity	Fallow Fields Intensity	0	Habitat						2019-05-07
Fallow Fields Proximity	Fallow Fields Proximity	0	Habitat						2019-05-07
Famoxadone	Famoxadone	131807573	Organics	Pesticides	Fungicides				2016-03-10
Famphur	Famphur	52857	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Fenamidone	Fenamidone	161326347	Organics	Pesticides	Fungicides				2016-03-10
Fenamiphos	Fenamiphos (Phosphoramidic acid, Isopropyl-, 4-(methylthio)-m-tolyl Ethyl Ester)	22224926	Organics	Pesticides	Pest-Ops	Insecticides			2013-05-28
Fenamiphos sulfone	Fenamiphos sulfone	31972448	Organics	Pesticides					2017-04-20
Fenamiphos sulfoxide	Fenamiphos sulfoxide	31972437	Organics	Pesticides					2017-04-20
Fenarimol	Fenarimol	60168889	Organics	Pesticides	Fungicides				2016-03-10
Fenbuconazole	Fenbuconazole	114369436	Organics	Pesticides	Fungicides				2016-03-10
Fenbutatin-Oxide	Fenbutatin-Oxide	0	Organics	Pesticides	Insecticides				2017-04-04
Fenchlorphos	Fenchlorphos (Ronnel)	299843	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Fenhexamid	Fenhexamid	126833178	Organics	Pesticides	Fungicides				2016-03-10
Fenitrothion	Fenitrothion	122145	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Fenoxycarb	Fenoxycarb	0	Organics	Pesticides	Insecticides				2017-04-04
Fenpropathrin	Fenpropathrin (Danitol)	39515418	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2013-05-28
Fenpropathrin-d6(Surrogate)	Surrogate: Fenpropathrin-d6	0	Organics	Pesticides	Pest-Pyrethroids	Insecticides			2017-05-25
Fenpyroximate	Fenpyroximate	134098616	Organics	Pesticides	Insecticides				2016-03-10
Fensulfothion	Fensulfothion	115902	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Fenthion	Fenthion (Mercaptophos)	55389	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Fenuron	Fenuron	101428	Organics	Pesticides	Herbicides				2007-07-27
Fenuron trichloroacetate	Fenuron trichloroacetate	4482557	Organics	Pesticides					2017-04-20
Fenvalerate	Fenvalerate	51630581	Organics	Pesticides					2016-05-20
Fenvalerate-d5(Surrogate)	Surrogate: Fenvalerate-d5	0	Organics	Pesticides	Pest-Pyrethroids				2020-06-26
Feral Pig Disturbance Extent	Feral Pig Disturbance Extent	0	Habitat						2019-05-07
Feral Pig Disturbance Intensity	Feral Pig Disturbance Intensity	0	Habitat						2019-05-07
Feral Pig Disturbance Proximity	Feral Pig Disturbance Proximity	0	Habitat						2019-05-07
Ferbam	Ferbam	0	Organics	Pesticides	Fungicides				2017-04-04
Fertilization	Fertilization (%)	0	Toxicity						2007-07-27
Fertilized eggs per nest	Fertilized eggs per nest (#)	0	Toxicity						2007-07-27
Filling Time	Time to fill a collection device with water	0	Habitat						2009-08-27
FinalSampleExtVolume	Final post-processing volume	0	Laboratory	Ancillary					2014-02-05
Fine	Fine	0	Inorganics	Conventionals	GrainSize				2011-09-08
Fipronil	Fipronil	120068373	Organics	Pesticides	Insecticides				2009-08-19
Fipronil Amide	Fipronil Amide	0	Organics	Pesticides	Insecticides				2014-11-03
Fipronil Desulfinyl	Fipronil Desulfinyl	0	Organics	Pesticides	Insecticides				2013-05-28
Fipronil Desulfinyl Amide	Fipronil Desulfinyl Amide	0	Organics	Pesticides	Insecticides				2014-11-03
Fipronil Desulfinyl-13C4 15N2(Surrogate)	Surrogate: Fipronil Desulfinyl-13C4 15N2	0	Organics	Pesticides	Fipronils				2019-06-03
Fipronil DetrifluoroMethylsulfinyl	Fipronil DetrifluoroMethylsulfinyl	120068793	Organics	Pesticides	Fipronils				2018-07-26
Fipronil Detrifluoromethylsulfinyl-13C4 15N2(Surrogate)	Surrogate: Fipronil Detrifluoromethylsulfinyl-13C4 15N2	0	Organics	Pesticides	Fipronils				2019-06-03
Fipronil Sulfide	Fipronil Sulfide	120067836	Organics	Pesticides	Insecticides				2009-08-19
Fipronil Sulfide-13C4 15N2(Surrogate)	Surrogate: Fipronil Sulfide-13C4 15N2	0	Organics	Pesticides	Fipronils				2019-06-03
Fipronil Sulfone	Fipronil Sulfone	0	Organics	Pesticides	Insecticides				2013-05-28
Fipronil Sulfone-13C4 15N2(Surrogate)	Surrogate: Fipronil Sulfone-13C4 15N2	0	Organics	Pesticides	Fipronils				2019-06-03
Fipronil-13C4 15N2(Surrogate)	Surrogate: Fipronil-13C4 15N2	0	PESTICIDES	Fipronils					2016-10-05
Fipronil-13C4(Surrogate)	Surrogate: Fipronil-13C4	0							2021-02-12
Fipronil-C13(Surrogate)	Surrogate: Fipronil-C13	0	Organics	Pesticides					2018-03-04
Fire Breaks Extent	Fire Breaks Extent	0	Habitat						2019-05-07
Fire Breaks Intensity	Fire Breaks Intensity	0	Habitat						2019-05-07
Fire Breaks Proximity	Fire Breaks Proximity	0	Habitat						2019-05-07
Fireworks	Fireworks	0	Debris	Trash	Non-Plastics	Toxic			2014-11-04
Fish Cover Artificial Structures	Fish Cover/Instream Habitat Complexity ? Other Artificial Structures	0	Habitat						2009-08-20
Fish Cover Boulders	Fish Cover/Instream Habitat Complexity ? Other Boulders	0	Habitat						2009-08-20
Fish Cover Filamentous Algae	Fish Cover/Instream Habitat Complexity - Other Filamentous Algae	0	Habitat						2009-08-20
Fish Cover Live Trees/Roots	Fish Cover/Instream Habitat Complexity ? Other Live Trees or Roots	0	Habitat						2009-08-20
Fish Cover Macrophytes	Fish Cover/Instream Habitat Complexity - Macrophytes	0	Habitat						2009-08-20
Fish Cover Overhang.Veg	Fish Cover/Instream Habitat Complexity ? Other Overhanging Vegetation =<1 m of surface	0	Habitat						2009-08-20
Fish Cover Undercut Banks	Fish Cover/Instream Habitat Complexity ? Other Undercut Banks	0	Habitat						2009-08-20
Fish Cover Woody Debris <0.3 m	Fish Cover/Instream Habitat Complexity ? Other Woody Debris <0.3 m	0	Habitat						2009-08-20
Fish Cover Woody Debris >0.3 m	Fish Cover/Instream Habitat Complexity ? Other Woody Debris >0.3 m	0	Habitat						2009-08-20
Fish Stocking	Fish Stocking	0	Habitat						2009-08-20
Fishing Line/Net	Fishing Line/Net	0	Debris	Trash	Plastics	Miscellaneous			2014-11-04
Float Time	Float time of observed object	0	Habitat						2009-12-10
Floatables	Floatables	0	Habitat						2014-04-17
Flonicamid	Flonicamid	158062670	Organics	Pesticides	Insecticides				2016-03-10
Florpyrauxifen-Benzyl	Florpyrauxifen-Benzyl	1390661729	Organics						2022-10-28
Flow Diversions Extent	Flow Diversions Extent	0	Habitat						2019-05-07
Flow Diversions Intensity	Flow Diversions Intensity	0	Habitat						2019-05-07
Flow Diversions Proximity	Flow Diversions Proximity	0	Habitat						2019-05-07
Fluazifop-P-butyl	Fluazifop-P-butyl	0	Organics	Pesticides	Herbicides				2017-04-04
Fluazinam	Fluazinam	79622596	Organics	Pesticides	Fungicides				2016-03-10
Flubendiamide	Flubendiamide	272451657	Organics						2018-07-16
Fluchloralin	Fluchloralin	0	Organics	Pesticides	Herbicides				2017-04-04
Flucythrinate	Flucythrinate	70124775	Organics	Pesticides	Pyrethroids				2011-05-14
Fludioxonil	Fludioxonil	131341861	Organics	Pesticides	Fungicides				2016-03-10
Flufenacet	Flufenacet	142459583	Organics	Pesticides	Herbicides				2016-03-10
Fluindapyr	Fluindapyr	1383809877	Organics						2022-10-28
Flumequine	Flumequine	42835256	Organics	PPCPs					2010-04-26
Flumetralin	Flumetralin	62924703	Organics	Pesticides	Herbicides				2016-03-10
Flumetsulam	Flumetsulam	98967409	Organics	Herbicides					2013-05-20
Flumioxazin	Flumioxazin	103361097	Organics	Pesticides					2018-03-21
Fluocinonide	Fluocinonide	356127	Organics	PPCPs					2010-04-26
Fluometuron	Fluometuron	2164172	Organics	Pesticides	Herbicides				2007-07-27
Fluopicolide	Fluopicolide	239110157	Organics	Pesticides	Fungicides				2016-03-10
Fluopyram	Fluopyram	658066354	Organics	Pesticides	Fungicides				2017-06-07
Fluoranthene	Fluoranthene	206440	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Fluoranthene/Pyrenes, C1-	C1-Fluoranthene/Pyrenes	0	Organics	PAHs	SVOCs	HMW_PAH			2010-06-21
Fluoranthene-d10(Surrogate)	Surrogate: Fluoranthene-d10	206440	Organics	PAHs					2012-04-04
Fluoranthenes/Pyrenes, C2-	C2-Fluoranthenes/Pyrenes	0	Organics	PAHs					2014-01-28
Fluoranthenes/Pyrenes, C3-	C3-Fluoranthenes/Pyrenes	0	Organics	PAHs					2014-01-28
Fluoranthenes/Pyrenes, C4-	C4-Fluoranthenes/Pyrenes	0	Organics	PAHs	Alkylated PAHs				2018-07-24
Fluorene	Fluorene	86737	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Fluorene-d10(Surrogate)	Surrogate: Fluorene-d10	0	Organics	PAHs					2014-01-28
Fluorenes, C1-	C1-Fluorenes	0	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Fluorenes, C2-	C2-Fluorenes	0	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Fluorenes, C3-	C3-Fluorenes	0	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Fluorescence	Fluorescence	0	WaterQualityMeasurements						2012-05-22
Fluoridamid	Fluoridamid (Acetamide)	0	Organics	Pesticides	Herbicides				2017-04-04
Fluoride	Fluoride	16984488	Inorganics	Conventionals					2007-07-27
Fluoro-2,3',6-Tribromodiphenyl Ether, 4'-(Surrogate)	Surrogate: 4'-Fluoro-2,3',6-tribromodiphenyl Ether	863314867	Organics	PBDEs					2013-05-28
Fluorobenzene	Fluorobenzene	462066	Organics	Organofluorides					2010-11-01
Fluorobenzene(Surrogate)	Surrogate: Fluorobenzene	462066							2020-07-15
Fluorobiphenyl, 2-	2-Fluorobiphenyl	321608	Organics	SVOCs					2016-05-20
Fluorobiphenyl, 2-(Surrogate)	Surrogate: 2-Fluorobiphenyl	321608	Organics	VOCs					2016-03-02
Fluoroelastomer Fiber	Fluoroelastomer Fiber	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Fluoroelastomer Fiber Bundle	Fluoroelastomer Fiber Bundle	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Fluorophenol, 2-	2-Fluorophenol	367124	Organics	VOCs					2016-05-20
Fluorophenol, 2-(Surrogate)	Surrogate: 2-Fluorophenol	367124	Organics	VOCs	Phenols	non-Chlorinated Phenols			2016-03-02
Fluorotelomer Carboxylic Acid, 10:2-	10:2-Fluorotelomer Carboxylic Acid?(FTCA)	0	Organics	PFAS	PFC Precursor				2014-10-20
Fluorotelomer Carboxylic Acid, 3:3-	3:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorohexanoic acid) (3:3 FTCA)	356025	Organics	PFAS					2021-06-02
Fluorotelomer Carboxylic Acid, 5:3-	5:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorooctanoic acid) (5:3 FTCA)	914637493	Organics	PFAS					2021-06-02
Fluorotelomer Carboxylic Acid, 6:2-	6:2-Fluorotelomer Carboxylic Acid?(FTCA)	0	Organics	PFAS	PFC Precursor				2014-10-20
Fluorotelomer Carboxylic Acid, 7:3-	7:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorodecanoic acid) (7:3 FTCA)	812704	Organics	PFAS					2021-06-02
Fluorotelomer Carboxylic Acid, 8:2-	8:2-Fluorotelomer Carboxylic Acid?(FTCA)	0	Organics	PFAS	PFC Precursor				2014-10-20
Fluorotelomer Carboxylic Acid-13C2, 10:2-(Surrogate)	Surrogate: 10:2-Fluorotelomer Carboxylic Acid-13C2	0	Organics	PFAS	PFC Precursor				2014-11-03
Fluorotelomer carboxylic acid-13C2, 6:2-(Surrogate)	Surrogate: 6:2-Fluorotelomer carboxylic acid-13C2	0	Organics	PFAS					2014-10-02
Fluorotelomer Carboxylic Acid-13C2, 8:2-(Surrogate)	Surrogate: 8:2-Fluorotelomer Carboxylic Acid-13C2	0	Organics	PFAS	PFC Precursor				2014-11-03
Fluorotelomer Sulfonate, 4:2-	4:2-Fluorotelomer Sulfonate (4:2 FTS)	0	Organics	PFAS	PFC Precursor				2014-10-20
Fluorotelomer Sulfonate, 6:2-	6:2-Fluorotelomer Sulfonate (6:2 FTS)	0	Organics	PFAS	PFC Precursor				2014-10-20
Fluorotelomer Sulfonate, 8:2-	8:2-Fluorotelomer Sulfonate (8:2 FTS)	0	Organics	PFAS	PFC Precursor				2014-10-20
Fluorotelomer Sulfonate-13C, 6:2-(Surrogate)	Surrogate: 6:2-Fluorotelomer Sulfonate-13C	0	Organics	PFAS	PFC Precursor				2014-11-03
Fluorotelomer Sulfonate-13C2, 4:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 4:2-Fluorotelomer Sulfonate-13C2 (4:2 FTS)	0	Organics						2022-03-04
Fluorotelomer Sulfonate-13C2, 4:2-(Surrogate)	Surrogate: Fluorotelomer Sulfonate-13C2, 4:2- (4:2 FTS)	0	Organics	PFAS					2021-06-02
Fluorotelomer Sulfonate-13C2, 6:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 6:2-Fluorotelomer Sulfonate-13C2 (6:2 FTS)	0	Organics						2022-03-11
Fluorotelomer Sulfonate-13C2, 6:2-(Surrogate)	Surrogate: Fluorotelomer Sulfonate-13C2, 6:2- (6:2 FTS)	0	Organics	PFAS		FlameRetardants			2021-08-20
Fluorotelomer Sulfonate-13C2, 8:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 8:2-Fluorotelomer Sulfonate-13C2 (8:2 FTS)	0	Organics						2022-03-04
Fluorotelomer Sulfonate-13C2, 8:2-(Surrogate)	Surrogate: Fluorotelomer Sulfonate-13C2, 8:2- (8:2 FTS)	0	Organics	PFAS					2021-06-02
Fluorotelomer Unsaturated Carboxylic Acid, 10:2-	10:2-Fluorotelomer Unsaturated Carboxylic Acid?(FTuCA)	0	Organics	PFAS	PFC Precursor				2014-10-20
Fluorotelomer Unsaturated Carboxylic Acid, 6:2-	6:2-Fluorotelomer Unsaturated Carboxylic Acid?(FTuCA)	0	Organics	PFAS	PFC Precursor				2014-10-20
Fluorotelomer Unsaturated Carboxylic Acid, 8:2-	8:2-Fluorotelomer Unsaturated Carboxylic Acid (FTuCA)	0	Organics	PFAS	PFC Precursor				2014-10-20
Fluorotelomer Unsaturated Carboxylic Acid-13C2, 10:2-(Surrogate)	Surrogate: 10:2-Fluorotelomer Unsaturated Carboxylic Acid-13C2	0	Organics	PFAS	PFC Precursor				2014-11-03
Fluorotelomer Unsaturated Carboxylic Acid-13C2, 6:2-(Surrogate)	Surrogate: 6:2-Fluorotelomer Unsaturated Carboxylic Acid-13C2	0	Organics	PFAS	PFC Precursor				2014-11-03
Fluoxastrobin	Fluoxastrobin	193740760	Organics	Pesticides	Fungicides				2016-03-10
Fluoxetine	Fluoxetine	54910893	Organics	PPCPs					2012-05-22
Fluoxetine-d5(Surrogate)	Surrogate: Fluoxetine-d5	0	Organics	PPCPs					2010-04-26
Flupyradifurone	Flupyradifurone	951659408	Organics	Pesticides	Insecticides				2018-01-03
Fluridone	Fluridone	59756604	Organics	Pesticides					2008-11-17
Fluridone(Surrogate)	Surrogate: Fluridone	59756604	Organics	Pesticides	Pest-Pyrethroids				2010-05-02
Flusilazole	Flusilazole	85509199	Organics	Pesticides	Fungicides				2016-03-10
Fluticasone Propionate	Fluticasone Propionate	80474142	Organics	PPCPs					2013-05-29
Flutolanil	Flutolanil	66332965	Organics	Fungicides					2016-05-20
Flutriafol	Flutriafol	76674210	Organics	Pesticides	Fungicides				2016-03-10
Fluvalinate	Fluvalinate	0	Organics	Pesticides					2016-05-20
Fluxapyroxad	Fluxapyroxad	907204313	Organics	Pesticides	Fungicides				2016-03-10
Foam Ball	Foam Ball	0	Debris	Trash	Plastics	Miscellaneous			2014-11-04
Foliose Algae	Foliose Algae	0	Debris	Trash	Non-Plastics	Marine Origin			2014-11-04
Folpet	Folpet	133073	Organics	Pesticides	Fungicides				2016-10-25
Fonofos	Fonofos (Dyfonate)	944229	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Fonofos(Surrogate)	Surrogate: Fonofos	0	Organics	Pesticides	OrganophosphatePest.	Insecticides			2011-07-15
Food Service	Food Service	0	Debris	Trash	Plastics				2014-11-05
Food Service, Other	Food Service, Other	0	Debris	Trash	Plastics	FoodService			2014-11-04
Forest Dominant Age Class	Forest Dominant Age Class	0	Habitat						2009-08-20
Formaldehyde	Formaldehyde (Methanal)	0	Organics	Pesticides					2017-04-04
Formate	Formate	0	Organics						2017-05-03
Formate(Surrogate)	Surrogate: Formate	0	Organics						2017-08-10
Formetanate hydrochloride	Formetanate hydrochloride	0	Organics	Pesticides	Insecticides				2017-04-04
Fosetyl-al, Technical	Fosetyl-aluminum, Technical	39148248	Organics	Pesticides					2017-04-10
FPOM	Fine particulate organic matter	0	Habitat						2012-09-12
Furniture	Furniture	0	Debris	Trash	Plastics	Non-Plastics			2014-11-04
Furosemide	Furosemide	54319	Organics	PPCPs					2010-04-26
Gadolinium	Gadolinium	7440542	Inorganics	Metals					2018-08-28
Gage Height	Water surface level measured against a staff gage within a given waterbody	0	Habitat						2012-12-04
Galaxolide	Galaxolide	0	Organics	Pesticides					2008-06-27
Galaxolide-d6(Surrogate)	Galaxolide-d6(Surrogate)	0	Organics	PPCPs					2022-01-04
Gallium	Gallium	7440553	Inorganics						2013-05-20
Garbage Bag of Trash	Garbage Bag of Trash	0	Debris	Trash	Non-Plastics	Large			2014-11-04
Gasoline	Gasoline	0	Organics						2010-08-10
Gemfibrozil	Gemfibrozil	25812300	Organics	PPCPs					2012-05-22
Gemfibrozil-d6(IsoDilAnalogue)	Isotope Dilution Analogue: Gemfibrozil-d6	1184986455	Organics						2022-07-22
Gemfibrozil-d6(Surrogate)	Surrogate: Gemfibrozil-d6	25812300	Organics	PPCPs					2016-03-02
Germination	Germination (%)	0	Toxicity						2007-07-27
Giardia	Giardia	0	Microbiological	Pathogens	Conventionals				2013-05-28
Giardia Cysts Fluorescence Antibody	Giardia Cysts Fluorescence Antibody	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts Negative	Giardia Cysts Negative	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/Amorphous Structure	Giardia Cysts/Amorphous Structure	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/DAPI & DIC Positive	Giardia Cysts/DAPI & DIC Positive	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/Empty	Giardia Cysts/Empty	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/Flourescence Antibody	Giardia Cysts/Flourescence Antibody	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/Internal Structure	Giardia Cysts/Internal Structure	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/Internal Structure (>One)	Giardia Cysts/Internal Structure (>One)	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/Internal Structure (One)	Giardia Cysts/Internal Structure (One)	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/Internal Structures (>One)	Giardia Cysts/Internal Structures (>One)	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/Negative	Giardia Cysts/Negative	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/Positive	Giardia Cysts/Positive	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/Positive (Internal Staining)	Giardia Cysts/Positive (Internal Staining)	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/Positive (Stained Nuclei)	Giardia Cysts/Positive (Stained Nuclei)	0	Microbiological	Pathogens					2017-03-27
Giardia Cysts/Total IFA Count	Giardia Cysts/Total IFA Count	0	Microbiological	Pathogens					2017-03-27
Glass	Glass using Trash Protocol	0	Trash						2011-05-04
Glass Foam	Glass Foam	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Glass fragment	Glass fragment	0	Microdebris	Anthropogenic	Glass	Fragment			2018-04-26
Glass Servicewear	Glass Servicewear	0	Debris	Trash	Non-Plastics	Household			2014-11-04
Glass Shard	Glass Shard	0	Debris	Trash	Non-Plastics	Household			2014-11-04
Glass sphere	Glass sphere	0	Microdebris	Anthropogenic	Glass	Sphere			2018-04-26
Glide	Glide	0	Habitat						2009-08-20
Glide/Pool Bank Stability	Glide/Pool Bank Stability (used for EMAP RBP 20-score habitat characterization)	0	Habitat						2009-08-20
Glide/Pool Channel Alteration	Glide/Pool Channel Alteration	0	Habitat						2009-08-20
Glide/Pool Channel Flow Status	Glide/Pool Channel Flow Status	0	Habitat						2009-08-20
Glide/Pool Channel Sinuosity	Glide/Pool Channel Sinuosity	0	Habitat						2009-08-20
Glide/Pool Epifaunal Substrate	Glide/Pool Epifaunal Substrate	0	Habitat						2009-08-20
Glide/Pool Pool Substrate	Glide/Pool Pool Substrate	0	Habitat						2009-08-20
Glide/Pool Pool Variability	Glide/Pool Pool Variability	0	Habitat						2009-08-20
Glide/Pool Riparian Zone Width	Glide/Pool Riparian Zone Width	0	Habitat						2009-08-20
Glide/Pool Sediment Deposition	Glide/Pool Sediment Deposition	0	Habitat						2009-08-20
Glide/Pool Vegetative Protection	Glide/Pool Vegetative Protection	0	Habitat						2009-08-20
Glipizide	Glipizide	29094619	Organics	PPCPs					2010-04-26
Glipizide-d11(Surrogate)	Surrogate: Glipizide-d11	0	Organics	PPCPs					2010-04-26
Glufosinate	Glufosinate	0	Organics	Pesticides	Herbicides				2017-04-04
Glyburide	Glyburide	10238218	Organics	PPCPs					2010-04-26
Glyburide-d3(Surrogate)	Surrogate: Glyburide-d3	0	Organics	PPCPs					2010-04-26
Glyphosate	Glyphosate	1071836	Organics	Pesticides	Herbicides				2007-07-27
Glyphosate, isopropylamine salt	Glyphosate, isopropylamine salt	38641940	Organics	Pesticides					2017-04-20
Gold	Gold	0	Inorganics	Metals					2014-01-29
Golf Course/Parks/Sports Fields Extent	Golf Course/Parks/Sports Fields Extent	0	Habitat						2019-05-07
Golf Course/Parks/Sports Fields Intensity	Golf Course/Parks/Sports Fields Intensity	0	Habitat						2019-05-07
Golf Course/Parks/Sports Fields Proximity	Golf Course/Parks/Sports Fields Proximity	0	Habitat						2019-05-07
Gonad Index CI Mean	Gonad Index CI Mean	0	Tissue	Condition					2014-02-05
Gonad Index Standard Error	Gonad Index Standard Error	0	Tissue	Condition					2014-02-05
Grading/Compaction Extent	Grading/Compaction Extent	0	Habitat						2019-05-07
Grading/Compaction Intensity	Grading/Compaction Intensity	0	Habitat						2019-05-07
Grading/Compaction Proximity	Grading/Compaction Proximity	0	Habitat						2019-05-07
Granule	Granule	0	Inorganics	Conventionals	GrainSize				2011-09-08
Granule + Pebble	Granule + Pebble	0	Inorganics	Conventionals	GrainSize				2011-09-08
Gravel	Gravel	0	Inorganics	Conventionals	GrainSize				2011-09-08
Grazing_Recent	Evidence of grazing activiy by cattle within the past year	0	Habitat						2012-09-13
Gross Alpha	Gross Alpha	12587461	Radiochemistry						2013-05-20
Gross Beta	Gross Beta	12587472	Radiochemistry						2013-05-20
Groundwater Extraction Extent	Groundwater Extraction Extent	0	Habitat						2019-05-07
Groundwater Extraction Intensity	Groundwater Extraction Intensity	0	Habitat						2019-05-07
Groundwater Extraction Proximity	Groundwater Extraction Proximity	0	Habitat						2019-05-07
Growth (ash-free dry wt/surv indiv)	Growth (ash-free dry weight/surviving individual)	0	Toxicity	Endpoint					2014-02-05
Growth (Chlorophyll a fluorescence)	Growth (Chlorophyll a fluorescence)	0	Toxicity						2022-11-15
Growth (Chlorophyll a)	Growth (Chlorophyll a)	0	Toxicity						2017-12-15
Growth (gonad)	Growth (gonad)	0	Toxicity						2007-07-27
Growth (length head capsule)	Growth (length head capsule)	0	Toxicity						2007-07-27
Growth (length)	Growth (length)	0	Toxicity						2007-07-27
Growth (weight)	Growth (weight)	0	Tissue	Condition					2014-02-05
Growth (wt/surv indiv)	Growth (weight/surviving individual)	0	Toxicity						2007-07-27
Growth Ratio	Growth Ratio (final measurement / initial measurement)	0	Toxicity						2011-12-22
Growth Standard Error	Growth Standard Error	0	Tissue	Condition					2014-02-05
H_AqHab	Shannon diversity of natural instream cover types physical-habitat metric	0	Bioassessment						2021-01-28
H_SubNat	Shannon diversity of natural substrate types physical-habitat metric	0	Bioassessment						2021-01-28
HabitatType	HabitatType	0	FieldObservations	Habitat					2009-08-20
Halauxifen-methyl	Halauxifen-methyl	943831989	Organics						2022-10-28
Halofenozide	Halofenozide	0	Organics	Pesticides	Insecticides				2017-04-04
Halosulfuron Methyl	Halosulfuron Methyl	100784201	Organics	Pesticides	Herbicides				2016-10-25
Hard Plastic Piece, non-specific	Hard Plastic Piece, non-specific	0	Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Hardened Features Other Extent	Hardened Features Other Extent	0	Habitat						2019-05-07
Hardened Features Other Intensity	Hardened Features Other Intensity	0	Habitat						2019-05-07
Hardened Features Other Proximity	Hardened Features Other Proximity	0	Habitat						2019-05-07
Hardness as CaCO3	Hardness as CaCO3	0	Inorganics	Conventionals	WaterQualityMeasurements				2007-07-27
Hatchability	Hatchability (%)	0	Toxicity						2007-07-27
Hay Extent	Hay Extent	0	Habitat						2019-05-07
Hay Intensity	Hay Intensity	0	Habitat						2019-05-07
Hay Proximity	Hay Proximity	0	Habitat						2019-05-07
HCH, alpha-	alpha-Hexachlorocyclohexane (HCH) (alpha-BHC)	319846	Organics	Pesticides	Pest-OCHs	Insecticides			2013-05-28
HCH, alpha-(Surrogate)	Surrogate: alpha-Hexachlorocyclohexane (HCH) (alpha-BHC)	0	Organics	Pesticides					2014-01-28
HCH, beta-	beta-Hexachlorocyclohexane (HCH) (beta-BHC)	319857	Organics	Pesticides	Pest-OCHs	Insecticides			2013-05-28
HCH, beta-(Surrogate)	Surrogate: beta-Hexachlorocyclohexane (HCH) (beta-BHC)	319857	Organics	Pesticides					2016-03-02
HCH, delta-	delta-Hexachlorocyclohexane (HCH) (delta-BHC)	319868	Organics	Pesticides	Pest-OCHs	Insecticides			2013-05-28
HCH, delta-(Surrogate)	Surrogate: delta-Hexachlorocyclohexane (HCH) (delta-BHC)	0	Organics	Pesticides					2013-05-27
HCH, gamma-	gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane)	58899	Organics	Pesticides	Pest-OCHs	Insecticides			2013-05-28
HCH, gamma-(Surrogate)	Surrogate: gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane)	0	Organics	Pesticides					2013-05-29
HCH, gamma-/PCB 015/17/18	gamma-HCH/PCB 15/17/18	0	Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/18	gamma-HCH/PCB 15/18	0	Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/19	gamma-HCH/PCB 15/19	0	Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/20	gamma-HCH/PCB 15/20	0	Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/21	gamma-HCH/PCB 15/21	0	Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/22	gamma-HCH/PCB 15/22	0	Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/23	gamma-HCH/PCB 15/23	0	Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/24	gamma-HCH/PCB 15/24	0	Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/25	gamma-HCH/PCB 15/25	0	Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/26	gamma-HCH/PCB 15/26	0	Organics	Pesticides/PCBs					2014-02-01
HCH-d6, gamma-(IsoDilAnalogue)	Isotopic Dilution Analogue: HCH-d6, gamma-	0							2022-07-06
HCH-d6, gamma-(Surrogate)	Surrogate: gamma-Hexachlorocyclohexane-d6 (HCH-d6) (gamma-BHC-d6) (Lindane-d6)	0	Organics	Pesticides					2013-06-20
Heavy Urban Other Extent	Heavy Urban Other Extent	0	Habitat						2019-05-07
Heavy Urban Other Intensity	Heavy Urban Other Intensity	0	Habitat						2019-05-07
Heavy Urban Other Proximity	Heavy Urban Other Proximity	0	Habitat						2019-05-07
Helicobacter, Avian (GFD)	Avian Helicobacter, Assay name: GFD, 5'-TCGGCTGAGCACTCTAGGG-3', 5'-GCGTCTCTTTGTACATCCCA-3'	0	Microbiological						2023-01-27
Heneicosane, n-	n-Heneicosane	629947	Organics	Alkanes					2013-05-01
Hentriacontane, n-	n-Hentriacontane	630046	Organics	Alkanes					2013-05-01
Hepatitis A Virus	Hepatitis A Virus	0	Microbiological	Pathogens					2020-10-29
Heptachlor	Heptachlor	76448	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
Heptachlor Epoxide	Heptachlor Epoxide	1024573	Organics	Pesticides	Pest-OCHs	Insecticides			2013-05-28
Heptachlor Epoxide(Surrogate)	Surrogate: Heptachlor Epoxide	0	Organics	Pesticides					2008-11-17
Heptachlor Epoxide, cis-	cis-Heptachlor Epoxide	0	Organics	Pesticides					2016-05-20
Heptachlor Epoxide, trans-	trans-Heptachlor Epoxide	0	Organics	Pesticides					2016-05-20
Heptachlor Epoxide/Oxychlordane	Heptachlor Epoxide/Oxychlordane	0	Organics	Pesticides					2014-02-01
Heptachlor Epoxide-13C10(IsoDilAnalogue)	Isotopic Dilution Analogue: Heptachlor Epoxide-13C10	0							2022-07-06
Heptachlor Epoxide-13C10(Surrogate)	Surrogate: Heptachlor Epoxide-13C10	0	Organics	Pesticides					2013-06-17
Heptachlor Epoxide-13C10, cis-(Surrogate)	Surrogate: cis-Heptachlor Epoxide-13C10	0	Organics	Pesticides					2016-05-20
Heptachlor(Surrogate)	Surrogate: Heptachlor	0	Organics	Pesticides					2008-11-17
Heptachlor-13C10(IsoDilAnalogue)	Isotopic Dilution Analogue: Heptachlor-13C10	0							2022-07-06
Heptachlor-13C10(Surrogate)	Surrogate: Heptachlor-13C10	0	Organics	Pesticides					2013-06-17
Heptachlorobenzene	Heptachlorobenzene	0	Organics	Pesticides					2014-01-28
Heptacosane, n-	n-Heptacosane	593497	Organics	Alkanes					2013-05-01
Heptadecane, n-	n-Heptadecane	629787	Organics	Alkanes					2013-05-01
Hexabromobenzene	Hexabromobenzene (HBBZ)	87821	Organics	FlameRetardants					2010-01-04
Hexabromocyclododecane, alpha-	alpha-Hexabromocyclododecane (alpha-HBCDD)	0	Organics	FlameRetardants					2011-05-11
Hexabromocyclododecane, alpha-(Surrogate)	Surrogate: alpha-Hexabromocyclododecane (HBCDD)	0	Organics	FlameRetardants					2013-05-27
Hexabromocyclododecane, beta-	beta-Hexabromocyclododecane (beta-HBCDD)	0	Organics	FlameRetardants					2011-05-11
Hexabromocyclododecane, gamma-	gamma-Hexabromocyclododecane (gamma-HBCDD)	0	Organics	FlameRetardants					2011-05-11
Hexabromocyclododecane, Total	Total Hexabromocyclododecane (HBCDD)	3194556	Organics	FlameRetardants					2011-05-11
Hexabromocyclododecane-13C12(Surrogate)	Surrogate: Hexabromocyclododecane-13C12 (HBCDD)	0	Organics	FlameRetardants					2014-01-28
Hexachloro(phenyl)norbornene	Hexachloro(phenyl)norbornene (HCPN)	0	Organics	FlameRetardants					2015-07-16
Hexachlorobenzene	Hexachlorobenzene	118741	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2007-07-27
Hexachlorobenzene(Surrogate)	Surrogate: Hexachlorobenzene	0	Organics	Pesticides					2008-11-17
Hexachlorobenzene-13C6(IsoDilAnalogue)	Isotopic Dilution Analogue: Hexachlorobenzene-13C6	0							2022-07-06
Hexachlorobenzene-13C6(Surrogate)	Surrogate: Hexachlorobenzene-13C6	0	Organics	Pesticides					2013-06-17
Hexachlorobutadiene	Hexachlorobutadiene	87683	Organics	VOCs	SVOCs	Fungicides			2007-07-27
Hexachlorocyclopentadiene	Hexachlorocyclopentadiene (HCCPD)	77474	Organics	SVOCs					2007-07-27
Hexachlorocyclopentadienyldibromocyclooctane	Hexachlorocyclopentadienyldibromocyclooctane (HCDBCO)	51936551	Organics	FlameRetardants					2014-03-13
Hexachloroethane	Hexachloroethane	67721	Organics	SVOCs					2007-07-27
Hexacosane, n-	n-Hexacosane	0	Organics	Alkanes					2014-01-28
Hexadecane, n-	n-Hexadecane	0	Organics	Alkanes					2014-01-28
Hexahydro-1,3,5-trinitro-1,3,5-triazine	Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX)	121824	Organics						2019-12-18
Hexanone, 2-	2-Hexanone	591786	Organics	VOCs					2007-07-27
Hexazinone	Hexazinone	51235042	Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
High Concentration of Salts Extent	High Concentration of Salts Extent	0	Habitat						2019-05-07
High Concentration of Salts Intensity	High Concentration of Salts Intensity	0	Habitat						2019-05-07
High Concentration of Salts Proximity	High Concentration of Salts Proximity	0	Habitat						2019-05-07
High density polyethylene fragment	HDPE fragment, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment			2018-04-26
Highway >2 lanes Extent	Highway >2 lanes Extent	0	Habitat						2019-05-07
Highway >2 lanes Intensity	Highway >2 lanes Intensity	0	Habitat						2019-05-07
Highway >2 lanes Proximity	Highway >2 lanes Proximity	0	Habitat						2019-05-07
Hiking Trails	Hiking Trails	0	Habitat						2009-08-20
Holmium	Holmium	7440600	Inorganics						2013-05-20
Homeless Encampment, Distance from Transect	Homeless Encampment, Distance from Transect	0	Habitat	Debris					2014-11-04
Homeless Encampment, Distance from Transect Downstream	Homeless Encampment, Distance from Transect Downstream	0	Habitat	Debris					2014-11-04
Homeless Encampment, Distance from Transect Upstream	Homeless Encampment, Distance from Transect Upstream	0	Habitat	Debris					2014-11-04
Homeless Encampment, Within Transect	Homeless Encampment, Within Transect	0	Habitat	Debris					2014-11-04
Hopane, C29-	C29-Hopane	0	Organics	Hopanes					2014-01-28
Hopane, C30-	C30-Hopane	0	Organics	Hopanes					2014-01-28
Horses Extent	Horses Extent	0	Habitat						2019-05-07
Horses Intensity	Horses Intensity	0	Habitat						2019-05-07
Horses Proximity	Horses Proximity	0	Habitat						2019-05-07
Hose Piece	Hose Piece	0	Debris	Trash	Non-Plastics	Household			2014-11-04
Household	Household	0	Debris	Trash	Plastics				2014-11-05
Household, Other	Household, Other	0	Debris	Trash	Plastics	Non-Plastics			2014-11-04
HpCDD, 1,2,3,4,6,7,8-	1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD)	35822469	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HpCDD, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD)	35822469	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HpCDD-13C, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin-13C (HpCDD)	0	Organics	DioxinsDibenzofurans					2013-07-02
HpCDF, 1,2,3,4,6,7,8-	1,2,3,4,6,7,8-Heptachlorodibenzofuran (HpCDF)	67562394	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HpCDF, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran	0	Organics	DioxinsDibenzofurans					2015-06-22
HpCDF, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Heptachlorodibenzofuran	0	Organics	DioxinsDibenzofurans					2015-06-22
HpCDF, 1,2,3,4,7,8,9-	1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF)	55673897	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HpCDF, 1,2,3,4,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF)	67562394	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HpCDF-13C, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran-13C (HpCDF)	0	Organics	DioxinsDibenzofurans					2013-07-02
HpCDF-13C, 1,2,3,4,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran-13C (HpDDF)	0	Organics	DioxinsDibenzofurans					2013-07-02
Human Adenovirus		0							2018-02-13
Human Norovirus GI		0							2018-02-13
Human Norovirus GII		0							2018-02-13
Human Waste/Diaper	Human Waste/Diaper	0	Debris	Trash	Non-Plastics	Toxic			2014-11-04
HumanHealth	HumanHealth using Trash Protocol	0	Trash						2011-05-04
HxCDD, 1,2,3,4,7,8-	1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	39227286	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HxCDD, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	39227286	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HxCDD, 1,2,3,6,7,8-	1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	57653857	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HxCDD, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	57653857	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HxCDD, 1,2,3,7,8,9-	1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin (HxCDD)	19408743	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HxCDD-13C, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin-13C (HxCDD)	0	Organics	DioxinsDibenzofurans					2013-07-02
HxCDD-13C, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin-13C (HxCDD)	0	Organics	DioxinsDibenzofurans					2013-07-02
HxCDF, 1,2,3,4,7,8-	1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF)	70648269	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HxCDF, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF)	70648269	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HxCDF, 1,2,3,6,7,8-	1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF)	57117449	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HxCDF, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF)	57117449	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HxCDF, 1,2,3,7,8,9-	1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF)	72918219	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HxCDF, 1,2,3,7,8,9-(Surrogate)	Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF)	72918219	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HxCDF, 2,3,4,6,7,8-	2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF)	60851345	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HXCDF, 2,3,4,6,7,8-(Surrogate)	Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF)	60851345	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HxCDF-13C, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran-13C (HxCDF)	0	Organics	DioxinsDibenzofurans					2013-07-02
HxCDF-13C, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran-13C (HxCDF)	0	Organics	DioxinsDibenzofurans					2013-07-02
HxCDF-13C, 1,2,3,7,8,9-(Surrogate)	Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran-13C (HxCDF)	0	Organics	DioxinsDibenzofurans					2013-07-02
HxCDF-13C, 2,3,4,6,7,8-(Surrogate)	Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran-13C (HxCDF)	0	Organics	DioxinsDibenzofurans					2013-07-02
Hydramethylnon	Hydramethylnon	0	Organics	Pesticides	Insecticides				2017-04-04
Hydraulic Height	Height from bottom of stream to top of bankfull height or the summation of station water depth and bankfull height	0	Habitat						2013-05-17
Hydrochlorothiazide	Hydrochlorothiazide	58935	Organics	PPCPs					2010-04-26
Hydrocodone	Hydrocodone	125291	Organics	PPCPs					2010-04-26
Hydrocodone-d3(Surrogate)	Surrogate: Hydrocodone-d3	0	Organics	PPCPs					2010-04-26
Hydrocortisone	Hydrocortisone	50237	Organics	PPCPs					2010-04-26
Hydrocortisone-d4(Surrogate)	Surrogate: Hydrocortisone-d4	0	Organics	PPCPs					2010-04-26
Hydrogen Sulfide	Hydrogen Sulfide	0	WaterQualityMeasurements						2007-07-27
Hydrolyzable Phosphorus + Orthophosphate as P	Hydrolyzable Phosphorus + Orthophosphate as P	0	Inorganics	Conventionals					2013-05-20
Hydroperiod	Hydroperiod of the waterbody	0	Habitat						2012-09-13
Hydroxide	Hydroxide	14280309	Inorganics	Conventionals					2012-09-13
Hydroxide Alkalinity as CaCO3	Hydroxide Alkalinity as CaCO3	471341	Inorganics	Conventionals	WaterQualityMeasurements				1900-01-01
Hydroxy-amitriptyline, 10-	10-Hydroxy-amitriptyline	0	Organics	PPCPs					2010-04-26
Hydroxyatrazine, 2-	2-Hydroxyatrazine	2163680	Organics	Pesticides	Pest-Triazines				2010-05-18
Hydroxycarbofuran, 3-	3-Hydroxycarbofuran	16655826	Organics	Pesticides	Insecticides	Carbamates			2014-01-28
Hydroxydicamba, 5-	5-Hydroxydicamba	7600502	Organics	Pesticides					2017-04-10
Hydroxy-ibuprofen, 2-	2-Hydroxy-ibuprofen	0	Organics	PPCPs					2010-04-26
Hydroxy-Imidacloprid, 5-	5-Hydroxy-Imidacloprid	380912094	Organics	Pesticides					2018-08-07
Hydroxypropanal, 3-	3-Hydroxypropanal	2134294	Organics	Pesticides					2008-11-17
Ibuprofen	Ibuprofen	15687271	Organics	PPCPs					2012-05-22
Ibuprofen-13C3(Surrogate)	Surrogate: Ibuprofen-13C3	0	Organics	PPCPs					2010-04-26
Ibuprofen-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Ibuprofen-d3	121662144	Organics						2022-07-22
Imazalil	Imazalil	35554440	Organics	Pesticides	Fungicides				2016-03-10
Imazamox	Imazamox	114311329	Organics						2020-06-26
Imazapyr	Imazapyr	0	Organics	Pesticides	Herbicides				2017-04-04
Imazaquin	Imazaquin	81335377	Organics	Herbicides					2013-05-20
Imazethapyr	Imazethapyr	81335775	Organics	Herbicides					2013-05-20
Imidacloprid	Imidacloprid	138261413	Organics	PPCPs					2012-09-13
Imidacloprid guanidine	Imidacloprid guanidine	0	Organics	Pesticides					2017-04-20
Imidacloprid guanidine olefin	Imidacloprid guanidine olefin	0	Organics	Pesticides					2017-04-20
Imidacloprid olefin	Imidacloprid olefin	115086549	Organics	Pesticides					2017-04-20
Imidacloprid urea	Imidacloprid urea	120868668	Organics	Pesticides					2017-04-20
Imidacloprid-d4(Surrogate)	Surrogate: Imidacloprid-d4	0	Organics	Pesticides	Insecticides				2018-01-31
Imidaclothiz	Imidaclothiz	105843365	Organics	Pesticides					2018-08-07
Incised Height	Incised Height	0	Habitat						2009-08-20
Increment	Increment	0	Habitat						2009-08-20
Indaziflam	Indaziflam	950782862	Organics	Herbicides					2019-08-05
Indeno(1,2,3-c,d)pyrene	Indeno(1,2,3-c,d)pyrene	193395	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Indeno(1,2,3-c,d)pyrene-d12(Surrogate)	Surrogate: Indeno(1,2,3-c,d)pyrene-d12	0	Organics	PAHs					2012-04-04
Indole	Indole	120729	Organics						2018-07-16
Indoxacarb	Indoxacarb	173584446	Organics	Pesticides	Ozadiazine	Insecticides			2015-09-11
Industrial Extent	Industrial Extent	0	Habitat						2019-05-07
Industrial Intensity	Industrial Intensity	0	Habitat						2019-05-07
Industrial Plants	Industrial Plants	0	Habitat						2009-08-20
Industrial Proximity	Industrial Proximity	0	Habitat						2019-05-07
Industrial Water Quality Other Extent	Industrial Water Quality Other Extent	0	Habitat						2019-05-07
Industrial Water Quality Other Intensity	Industrial Water Quality Other Intensity	0	Habitat						2019-05-07
Industrial Water Quality Other Proximity	Industrial Water Quality Other Proximity	0	Habitat						2019-05-07
Inorganic natural material	Inorganic natural material, including rock and minerals	0	Microdebris	Natural	Natural	Natural			2018-04-26
Inorganic Natural Material Fiber	Inorganic natural material Fiber	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Inorganic Natural Material Film	Inorganic natural material Film	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Inorganic Natural Material Foam	Inorganic natural material Foam	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Inorganic Natural Material Fragment	Inorganic natural material Fragment	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Inorganic Natural Material Sphere	Inorganic natural material Sphere	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Instream Plant Cover	Instream Plant Cover	0	Habitat						2011-11-01
IntertidalSubstrateCharacteristics_Mud	IntertidalSubstrateCharacteristics_Mud	0	Habitat	Debris					2014-11-04
IntertidalSubstrateCharacteristics_Rocky	IntertidalSubstrateCharacteristics_Rocky	0	Habitat	Debris					2014-11-04
IntertidalSubstrateCharacteristics_Sand	IntertidalSubstrateCharacteristics_Sand	0	Habitat	Debris					2014-11-04
IntertidalSubstrateCharacteristics_Vegetated	IntertidalSubstrateCharacteristics_Vegetated	0	Habitat	Debris					2014-11-04
Invasive Plants Extent	Invasive Plants Extent	0	Habitat						2019-05-07
Invasive Plants Intensity	Invasive Plants Intensity	0	Habitat						2019-05-07
Invasive Plants Proximity	Invasive Plants Proximity	0	Habitat						2019-05-07
Iodomethane	Iodomethane	74884					Organics	Pesticide	2016-07-29
Iohexol	Iohexol	66108950							2018-08-31
Iopromide	Iopromide	73334073							2018-08-31
Ioxynil	Ioxynil	0	Organics	Pesticides	Herbicides				2017-04-04
Ipconazole	Ipconazole	125225287	Organics	Pesticides	Fungicides				2016-07-27
IPI	Score for the Index of Physical-habitat Integrity (IPI)	0	Bioassessment						2021-01-28
IPI_Ev_FlowHab_qa	Quality assurance metric for the evenness of flow habitat types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	Bioassessment						2021-01-28
IPI_Ev_FlowHab_score	Scored evenness of flow habitat types physical-habitat metric	0	Bioassessment						2021-01-28
IPI_H_AqHab_pred	Predicted Shannon diversity of natural instream cover types physical-habitat metric	0	Bioassessment						2021-01-28
IPI_H_AqHab_qa	Quality assurance metric for the Shannon diversity of natural instream cover types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	Bioassessment						2021-01-28
IPI_H_AqHab_score	Scored Shannon diversity of natural instream cover types physical-habitat metric	0	Bioassessment						2021-01-28
IPI_H_SubNat_qa	Quality assurance metric for the Shannon diversity of natural substrate types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	Bioassessment						2021-01-28
IPI_H_SubNat_score	Scored Shannon diversity of natural substrate types physical-habitat metric	0	Bioassessment						2021-01-28
IPI_IPI_qa	Quality assurance metric for the Index of Physical-habitat Integrity score, calculated as the minimum of other quality assurance metric values	0	Bioassessment						2021-01-28
IPI_PCT_SAFN_pred	Predicted percent sands and fines streambed substrate physical-habitat metric	0	Bioassessment						2021-01-28
IPI_PCT_SAFN_qa	Quality assurance metric for the percent sands and fines physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	Bioassessment						2021-01-28
IPI_PCT_SAFN_score	Scored percent sands and fines streambed substrate physical-habitat metric	0	Bioassessment						2021-01-28
IPI_XCMG_pred	Predicted riparian cover as sum of three layers physical-habitat metric	0	Bioassessment						2021-01-28
IPI_XCMG_qa	Quality assurance metric for the riparian cover metric, calculated as the percent of expected measurements present in the input data	0	Bioassessment						2021-01-28
IPI_XCMG_score	Scored riparian cover as sum of three layers physical-habitat metric	0	Bioassessment						2021-01-28
Iprodione	Iprodione	36734197	Organics	Fungicides					2016-05-20
IQ Test - Fluorescence (EC50)	IQ Test - Fluorescence (EC50)	0	Toxicity						2007-07-27
Iron	Iron	7439896	Inorganics	Conventionals	Metals				2007-07-27
Irrigation Equipment	Irrigation Equipment	0	Habitat						2009-08-20
Isoborneol	Isoborneol	124765	Organics						2018-07-16
Isobutylparaben	Isobutylparaben	4247023							2021-05-07
Isodecyl Diphenyl Phosphate	Isodecyl Diphenyl Phosphate	29761215	Organics	FlameRetardants	PhosphateFlameRetardants				2017-09-19
Isodrin	Isodrin	0	Organics	Pesticides					2008-11-07
Isodrin-13C12(Surrogate)	Surrogate: Isodrin-13C12	0	Organics	Pesticides					2013-06-17
Isofenphos	Isofenphos	25311711	Organics	Pesticides					2016-10-25
Isofetamid	Isofetamid	875915789	Organics						2018-07-16
Isophorone	Isophorone	78591	Organics	SVOCs					2007-07-27
Isopropalin	Isopropalin	0	Organics	Pesticides	Herbicides				2017-04-04
Isopropyl Alcohol	Isopropyl Alcohol (2-propanol)	67630							2017-01-12
Isopropylbenzene	Isopropylbenzene (Cumene)	98828	Organics	VOCs					2013-05-28
Isopropylphenyl Diphenyl Phosphate	Isopropylphenyl Diphenyl Phosphate	28108998	Organics	FlameRetardants	PhosphateFlameRetardants				2017-09-19
Isopropyltoluene, p-	p-Isopropyltoluene	99876	Organics	VOCs					2007-07-27
Isoproturon	Isoproturon	34123596							2021-05-07
Isoquinoline	Isoquinoline	119653	Organics						2018-07-16
Isotopes	Isotopes	0	Inorganics	Conventionals					2012-09-13
Isoxaben	Isoxaben (Flexidor) (Gallery)	82558507	Organics	Pesticides					2016-05-20
Isoxaben(Surrogate)	Surrogate: Isoxaben (Flexidor) (Gallery)	82558507	Organics	Herbicides					2013-05-28
ITEQ	International Toxic Equivalent (ITEQ)	0	Organics	DioxinsDibenzofurans					2010-07-15
Jasmolin-1	Jasmolin-1 (Jasmolin I)	4466142	Organics	Pesticides	Pyrethroids				2013-05-27
Jasmolin-2	Jasmolin-2 (Jasmolin II)	1172630	Organics	Pesticides	Pyrethroids				2013-05-27
Kelp holdfast	Kelp holdfast	0	Debris	Natural	Non-Plastics	Marine Origin			2014-11-04
Kelp Stipe/Blade	Kelp Stipe/Blade	0	Debris	Natural	Non-Plastics	Marine Origin			2014-11-04
Kepone	Kepone (Chlordecone)	143500	Organics	Pesticides	Pest-OCHs				2013-05-28
Ketocarbofuran phenol, 3-	3-ketocarbofuran phenol	17781167	Organics	Pesticides					2017-04-10
Ketocarbofuran, 3-	3-Ketocarbofuran	16709301	Organics	Pesticides	Pest-Carbamates				2013-05-20
Ketoprofen	Ketoprofen	22071154							2021-05-07
Ketorolac	Ketorolac	74103063							2021-05-07
Keyboard	Keyboard	0	Debris	Trash	Plastics	Toxic			2014-11-04
Kresoxim-methyl	Kresoxim-methyl	0	Organics	Fungicides					2016-05-20
Lachnospiraceae, Canine (DG37)	Canine Lachnospiraceae, Assay name: DG37, 5'-TTTTCTCCCACGGTCATCTG-3', 5'-CTTGGTTATGGGCGACATTG-3'	0	Microbiological						2023-01-27
Landfill Extent	Landfill Extent	0	Habitat						2019-05-07
Landfill Intensity	Landfill Intensity	0	Habitat						2019-05-07
Landfill Proximity	Landfill Proximity	0	Habitat						2019-05-07
Lanthanum	Lanthanum	7439910	Inorganics						2013-05-20
Large	Large using Trash Protocol	0	Trash						2011-05-04
Large/Unmovable, Other	Large/Unmovable, Other	0	Debris	Trash	Non-Plastics	Large			2014-11-04
Larval abnormality	Larval abnormality	0	Toxicity						2007-07-27
Lead	Lead	7439921	Inorganics	TraceElements	Metals				2007-07-27
Length	Length	0	Tissue	Habitat	WaterQualityMeasurements	Conventionals	CollectionDevice		2012-06-01
Length Downstream	Length Downstream from X location	0	Habitat						2013-05-28
Length Pool	Length Pool	0	Habitat						2012-05-22
Length Reach	Length Reach	0	Habitat						2013-05-28
Length Riffle	Length Riffle	0	Habitat						2012-05-22
Length Root	Length Root	0	Toxicity						2013-05-28
Length Shoot	Length Shoot	0	Toxicity						2013-05-28
Length Upstream	Length Upstream from X location	0	Habitat						2013-05-28
Length, Segment	Segment Length	0	Habitat						2009-08-20
Leptophos	Leptophos	21609905	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Level Of Trash	Level Of Trash using Trash Protocol	0	Trash						2011-05-04
Lid	Lid	0	Debris	Trash	Plastics	FoodService			2014-11-04
Lidocaine	Lidocaine	137586							2021-05-07
Light Urban Other Extent	Light Urban Other Extent	0	Habitat						2019-05-07
Light Urban Other Intensity	Light Urban Other Intensity	0	Habitat						2019-05-07
Light Urban Other Proximity	Light Urban Other Proximity	0	Habitat						2019-05-07
Lighter	Lighter	0	Debris	Trash	Plastics	Toxic			2014-11-04
Liming	Liming	0	Habitat						2009-08-20
Limonene, d-	d-Limonene	0	Organics						2018-07-16
Lincomycin	Lincomycin	154212	Organics	PPCPs					2012-05-22
Linuron	Linuron	330552	Organics	Pesticides	Herbicides				2007-07-27
Linuron-d6(Surrogate)	Surrogate: Linuron-d6	1219804768	Organics	Pesticides	Herbicides				2021-10-19
Lipid	Lipid	0	Organics	Inorganics	Conventionals				2007-07-27
Lithium	Lithium	7439932	Inorganics	Metals					2009-08-05
Littering	Littering using Trash Protocol	0	Trash						2011-05-04
Live young	Live young (#)	0	Toxicity						2007-07-27
Livestock Use	Livestock Use	0	Habitat						2009-08-20
Logging	Logging	0	Habitat						2009-08-20
Lomefloxacin	Lomefloxacin	98079517	Organics	PPCPs					2010-04-26
Loss On Ignition	Loss On Ignition (LOI)	0	Inorganics	Conventionals					2009-04-21
Low density polyethylene fragment	LDPE fragment, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment			2018-04-26
LWD >0.8 DLE, Length >15m	LWD >0.8 DLE, Length >15m	0	Habitat						2009-08-20
LWD >0.8m DLE, Length 1.5-5m	LWD >0.8m DLE, Length 1.5-5m	0	Habitat						2009-08-20
LWD >0.8m DLE, Length 5-15m	LWD >0.8m DLE, Length 5-15m	0	Habitat						2009-08-20
LWD 0.1-<0.3m DLE, Length >15m	LWD 0.1-<0.3m DLE, Length >15m	0	Habitat						2009-08-20
LWD 0.1-<0.3m DLE, Length 1.5-5m	LWD 0.1-<0.3m DLE, Length 1.5-5m	0	Habitat						2009-08-20
LWD 0.1-<0.3m DLE, Length 5-15m	LWD 0.1-<0.3m DLE, Length 5-15m	0	Habitat						2009-08-20
LWD 0.3-<0.6m DLE, Length >15	LWD 0.3-<0.6m DLE, Length >15	0	Habitat						2009-08-20
LWD 0.3-<0.6m DLE, Length 1.5-5m	LWD 0.3-<0.6m DLE, Length 1.5-5m	0	Habitat						2009-08-20
LWD 0.3-<0.6m DLE, Length 5-15m	LWD 0.3-<0.6m DLE, Length 5-15m	0	Habitat						2009-08-20
LWD 0.6-<0.8m DLE, Length >15m	LWD 0.6-<0.8m DLE, Length >15m	0	Habitat						2009-08-20
LWD 0.6-<0.8m DLE, Length 1.5-5m	LWD 0.6-<0.8m DLE, Length 1.5-5m	0	Habitat						2009-08-20
LWD 0.6-<0.8m DLE, Length 5-15	LWD 0.6-<0.8m DLE, Length 5-15	0	Habitat						2009-08-20
LWD A	Large Woody Debris in the A class of corresponding Diameter and Length categories	0	Habitat						2012-05-22
LWD L	Large Woody Debris in the L class of corresponding Diameter and Length categories	0	Habitat						2012-05-22
LWD M	Large Woody Debris in the M class of corresponding Diameter and Length categories	0	Habitat						2012-05-22
LWD S	Large Woody Debris in the S class of corresponding Diameter and Length categories	0	Habitat						2012-05-22
LWD T	Large Woody Debris in the T class of corresponding Diameter and Length categories	0	Habitat						2012-05-22
Lyngbyatoxin-a	Lyngbyatoxin-a	0	Microbiological	Cyanotoxins					2012-05-22
Macroalgae Cover, Attached	Presence/Absence of attached macroalgae at a point along a transect	0	Habitat						2008-12-04
Macroalgae Cover, Unattached	Presence/Absence of unattached macroalgae at a point along a transect	0	Habitat						2008-12-04
Macroinvertebrate Habitat Patch Richness Metric	Metric assesses macroinvertebrate habitat patch richness along the channel edge and bank within the assessment area.	0	Habitat						2019-05-13
Macrophyte Cover	Presence/Absence of macrophytes at a point along a transect	0	Habitat						2008-12-04
Magnesium	Magnesium	7439954	Inorganics	Conventionals	Metals	AlkalineEarthMetals	Constituents		2007-07-27
Maintained Lawns	Maintained Lawns	0	Habitat						2009-08-20
Malachite Green	Malachite Green	569642	Organics						2017-07-26
Malaoxon	Malaoxon	1634782	Organics	Pesticides					2016-03-10
Malathion	Malathion	121755	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Maleic hydrazide	Maleic hydrazide	0	Organics	Pesticides	Herbicides				2017-04-04
Male-specific F+ Coliphage (E. coli Famp)	Male-specific F+ coliphages, Host Bacterium Strain: E. coli Famp	0							2022-02-11
Mancozeb	Mancozeb	0	Organics	Pesticides	Fungicides				2017-04-04
Mandestrobin	Mandestrobin	173662970	Organics						2022-10-28
Mandipropamid	Mandipropamid	374726622	Organics	Pesticides	Fungicides				2016-09-06
Maneb	Maneb	0	Organics	Pesticides	Fungicides				2017-04-04
Manganese	Manganese	7439965	Inorganics	TraceElements	Metals	Conventionals			2007-07-27
Marbon CNB 23010-1	Marbon CNB 23010 (VCH-DP isomer 1)	26595573	Organics	FlameRetardants					2015-07-16
Marbon CNB 23010-2	Marbon CNB 23010 (VCH-DP isomer 2)	26595573	Organics	FlameRetardants					2015-07-16
Marine, Other	Marine, Other	0	Debris	Natural	Non-Plastics	Marine Origin			2014-11-04
Mature	Mature (%)	0	Toxicity						2007-07-27
Mature females	Mature females (%)	0	Toxicity						2007-07-27
MBAS	MBAS (Methylene Blue Active Substances)	0	Inorganics	Surfactants					2013-05-28
MCPA	MCPA (2-Methyl-4-chlorophenoxy)Acetic Acid) (2,4-MCPA)	94746	Organics	Herbicides					2013-05-28
MCPA, alkanolamine salt	MCPA, alkanolamine salt	0	Organics	Pesticides					2017-04-20
MCPA, butoxyethanol ester	MCPA, butoxyethanol ester	19480434	Organics	Pesticides					2017-04-20
MCPA, dimethylamine salt	MCPA, dimethylamine salt	2039465	Organics	Pesticides					2017-04-20
MCPA, isooctyl ester	MCPA, isooctyl ester	26544207	Organics	Pesticides					2017-04-20
MCPA, sodium salt	MCPA, sodium salt	3653483	Organics	Pesticides					2017-04-20
MCPP	MCPP (2-(2-Methyl-4-chlorophenoxy) Propionic Acid)	93652	Organics	Herbicides					2013-05-28
MCPP, diethanolamine salt	MCPP, diethanolamine salt	1432140	Organics	Pesticides					2017-04-20
MCPP, dimethylamine salt	MCPP, dimethylamine salt	32351705	Organics	Pesticides					2017-04-20
MCPP, potassium salt	MCPP, potassium salt	1929868	Organics	Pesticides					2017-04-20
Mean Grain Size	Mean Grain Size	0	Inorganics	Conventionals					2016-07-18
Mean Growth (Ash Free Dry Weight)	Mean Growth (Ash Free Dry Weight)	0	Toxicity	Endpoint					2014-02-05
Mean Percent Normal Alive	The observed number of normal larvae divided by the mean number of live embryos inoculated at the beginning of the test	0	Toxicity	Endpoint					2014-02-05
Mechanical Pencil	Mechanical Pencil	0	Debris	Trash	Plastics	Household			2014-11-04
Meclofenamic Acid	Meclofenamic Acid	644622							2021-05-07
Median Effective Concentration	Median Effective Concentration	0	Toxicity						2013-05-28
Median Grain Size	Median Grain Size	0	Inorganics	Conventionals					2016-07-11
Median Inhibatory Concentration	Median Inhibatory Concentration	0	Toxicity						2013-05-28
Medical Device	Medical Device	0	Debris	Trash	Plastics	Toxic			2014-11-04
Menthol	Menthol	0	Organics						2018-07-16
Meprobamate	Meprobamate	57534	Organics	PPCPs					2010-04-26
Mercuric Chloride	Mercuric Chloride	0	Inorganics	Metals					2017-04-04
Mercury	Mercury	7439976	Inorganics	TraceElements	Metals				2007-07-27
Mercury (II)R	Reactive Mercury	0	Inorganics	Metals					2014-01-29
Mercury, Acid Labile	Acid Labile Mercury	0	Inorganics	Metals					2014-01-29
Mercury, Extract Fraction 1	Mercury selective sequential extraction, Fraction 1	0	Inorganics						2020-10-27
Mercury, Extract Fraction 2	Mercury selective sequential extraction, Fraction 2	0	Inorganics						2020-10-27
Mercury, Extract Fraction 3	Mercury selective sequential extraction, Fraction 3	0	Inorganics						2020-10-27
Mercury, Extract Fraction 4	Mercury selective sequential extraction, Fraction 4	0	Inorganics						2020-10-27
Mercury, Extract Fraction 5	Mercury selective sequential extraction, Fraction 5	0	Inorganics						2020-10-27
Mercury, Methyl	Methyl Mercury	22967926	Inorganics	TraceElements	Metals				2007-07-27
Merphos	Merphos (Tributylphosphorotrithioite)	150505	Organics	Pesticides	Pest-OPs				2007-07-27
Mesh Size	Mesh Size	0	Tissue	Habitat					2009-08-20
Metabolite B	Metabolite B (metabolite of Benzobicyclon)	0							2017-12-12
Metal	Metal using Trash Protocol	0	Trash						2011-05-04
Metal Object	Metal Object	0	Debris	Trash	Non-Plastics	Metals			2014-11-04
Metal Pipe/Bar	Metal Pipe/Bar	0	Debris	Trash	Non-Plastics	Metals			2014-11-04
Metal, Other	Metal, Other	0	Debris	Trash	Non-Plastics	Metals			2014-11-04
Metalaxyl	Metalaxyl	57837191	Organics	Herbicides					2013-05-20
Metalaxyl-hydroxymethyl	Metalaxyl-hydroxymethyl	85933499	Organics						2022-11-03
Metaldehyde	Metaldehyde	0	Organics	Pesticides					2017-04-04
Metam-Sodium	Metam-Sodium	0	Organics	Pesticides					2017-04-04
Metazachlor	Metazachlor	67129082							2021-05-07
Metconazole	Metconazole	125116236	Organics	Fungicides					2016-05-20
MeterAveragingInterval	Time period (seconds) upon which the meter reading is averaged internally to attain a result	0	WaterQualityMeasurements						2012-05-22
Metformin	Metformin	657249	Organics	PPCPs					2010-04-26
Metformin-d6(Surrogate)	Surrogate: Metformin-d6	0	Organics	PPCPs					2010-04-26
Methadone	Methadone	76993							2018-08-20
Methamidophos	Methamidophos (O,S-Dimethyl thiophosphate)	10265926	Organics	Pesticides	Pest-OPs	Insecticides			2013-05-28
Methidathion	Methidathion	950378	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Methidathion oxon	Methidathion oxon	0	Organics	Pesticides					2017-04-20
Methiocarb	Methiocarb	2032657	Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
Methiocarb sulfone	Methiocarb sulfone	2179251	Organics	Pesticides					2017-04-20
Methiocarb sulfoxide	Methiocarb sulfoxide	2635101	Organics	Pesticides					2017-04-20
Methomyl	Methomyl	16752775	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Methoprene	Methoprene	40596698	Organics	Pesticides					2008-11-17
Methoxychlor	Methoxychlor	72435	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
Methoxychlor(Surrogate)	Surrogate: Methoxychlor	0	Organics	Pesticides	OrganochlorinePesticides	Semi-VOAs			2011-07-15
Methoxychlor-d6(Surrogate)	Surrogate: Methoxychlor-d6	0	Organics	Pesticides					2013-06-17
Methoxyfenozide	Methoxyfenozide	161050584	Organics	Pesticides	Insecticides				2016-03-10
Methoxy-methylsulfanylphosphoryl acetamide, N-	N-Methoxy-methylsulfanylphosphoryl acetamide (Acephate)	0	Organics	Pesticides	Insecticides				2017-04-04
Methyl (3,4-dichlorophenyl)carbamate	Methyl (3,4-dichlorophenyl)carbamate (Swep)	1918189	Organics	Pesticides	Pest-Carbamates				2013-05-28
Methyl 2,4-dichlorophenylacetate	Methyl 2,4-dichlorophenylacetate (2,4-DCAA)	55954239							2017-01-12
Methyl 3-Amino-2,5-dichlorobenzoate	Methyl 3-Amino-2,5-dichlorobenzoate (Chloramben Methyl)	7286840	Organics	Herbicides					2013-05-20
Methyl isothiocyanate	Methyl isothiocyanate	0	Organics	Pesticides	Herbicides				2017-04-04
Methyl paraoxon	Methyl paraoxon	950356	Organics	Pesticides					2017-04-20
Methyl Perfluorooctane Sulfonamido Acetic Acid, N-	N-Methyl Perfluorooctane Sulfonamido Acetic Acid (Me-PFOSA-AcOH)	0	Organics	PFAS	PFC Precursor				2014-10-20
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3 (N-MeFOSAA)	0	Organics						2022-02-24
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(Surrogate)	Surrogate: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3	0	Organics	PFAS	PFC Precursor				2014-11-03
Methyl salicylate	Methyl salicylate	119368	Organics						2018-07-16
Methyl Tert-butyl Ether	Methyl Tert-butyl Ether (MTBE)	1634044	Organics	VOCs	MTBE_BTEX				2013-05-28
Methyl triclosan	Methyl triclosan	4640011	Organics	PPCPs					2018-07-24
Methyl Triclosan-13C12(Surrogate)	Surrogate: Methyl Triclosan-13C12	0	Organics	PPCPs					2018-08-07
Methyl vinyl ether Co-polymers Fiber	Methyl vinyl ether copolymers Fiber	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Methyl vinyl ether Co-polymers Film	Methyl vinyl ether copolymers Film	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Methyl vinyl ether Co-polymers Foam	Methyl vinyl ether copolymers Foam	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Methyl vinyl ether Co-polymers Fragment	Methyl vinyl ether copolymers Fragment	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Methyl-1(H)-indole, 3-	3-Methyl-1(H)-indole (Skatole)	83341	Organics						2018-07-16
Methyl-1H-benzotriazole, 5-	5-Methyl-1H-benzotriazole	136856	Organics						2018-07-16
Methyl-2-pentanone, 4-	4-Methyl-2-pentanone (Methyl Isobutyl Ketone)	108101	Organics	VOCs					2013-05-28
Methylanthracene	Methylanthracene	0	Organics	PAHs					2014-01-28
Methylanthracene, 2-	2-Methylanthracene	613127	Organics	PAHs	Semi-VOAs				2010-07-08
Methylbenzo(a)pyrene, 7-	7-Methylbenzo(a)pyrene	63041770	Organics	PAHs					2013-08-27
Methylchlolanthrene, 3-	Methylchlolanthrene, 3-	0	Organics	PAHs					2016-05-20
Methylchrysene, 1-	1-Methylchrysene	0	Organics	PAHs					2014-01-28
Methylchrysene, 5/6-	5-Methylchrysene/6-Methylchrysene	0	Organics	PAHs					2011-06-20
Methyldibenzothiophene, 2-	2-Methyldibenzothiophene	0	Organics	PAHs					2014-01-28
Methyldibenzothiophene, 4-	4-Methyldibenzothiophene	7372885	Organics	PAHs	SVOCs				2007-07-27
Methyldibenzothiophenes, 2/3-	2-Methyldibenzothiophene/3-Methyldibenzothiophene	0	Organics	PAHs					2010-09-23
Methylene Chloride	Methylene Chloride (Dichloromethane)	75092	Organics	VOCs					2013-05-28
Methylenebis(2-chloroaniline), 4,4'-	4,4'-Methylenebis(2-chloroaniline)	0	Organics	VOCs					2014-01-29
Methylfluoranthene, 2-	2-Methylfluoranthene	33543316	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Methylfluoranthene, 3-	3-Methylfluoranthene	0	Organics	PAHs					2014-01-28
Methylfluoranthene, 3-/Benzo(a)fluorene	3-Methylfluoranthene/Benzo(a)fluorene	0	Organics	PAHs	HMW_PAH				2018-07-24
Methylfluorene, 1-	1-Methylfluorene	1730376	Organics	PAHs	SVOCs				2007-07-27
Methylfluorene, 2-	2-Methylfluorene	1430973	Organics	PAHs	Semi-VOAs				2010-07-08
Methylnaphthalene, 1-	1-Methylnaphthalene	90120	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Methylnaphthalene, 2-	2-Methylnaphthalene	91576	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Methylnaphthalene-d10, 2-(Surrogate)	Surrogate: 2-Methylnaphthalene-d10	0	Organics	PAHs					2012-04-04
Methylparaben	Methylparaben	99763							2021-05-07
Methyl-perfluorooctanesulfonamide, N-	N-Methyl-perfluorooctanesulfonamide	0	Organics	PFAS					2010-02-23
Methyl-perfluorooctanesulfonamide-d3, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl-perfluorooctanesulfonamide-d3 (N-MeFOSA)	0	Organics						2022-03-04
Methyl-perfluorooctanesulfonamide-d3, N-(Surrogate)	Surrogate: Methyl-perfluorooctanesulfonamide-d3, N- (N-MeFOSA)	0	Organics	PFAS					2021-06-02
Methyl-perfluorooctanesulfonamidoethanol, N-	N-Methyl-perfluorooctanesulfonamidoethanol	0	Organics	PFAS					2010-02-23
Methyl-perfluorooctanesulfonamidoethanol-d7, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl-perfluorooctanesulfonamidoethanol-d7 (N-MeFOSE)	0	Organics						2022-02-24
Methyl-perfluorooctanesulfonamidoethanol-d7, N-(Surrogate)	Surrogate: N-Methyl-perfluorooctanesulfonamidoethanol-d7	0	Organics	PFAS					2010-02-23
Methylphenanthrene	Methylphenanthrene	0	Organics						2017-05-04
Methylphenanthrene, 1-	1-Methylphenanthrene	832699	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Methylphenanthrene, 2-	2-Methylphenanthrene	0	Organics	PAHs					2014-01-28
Methylphenanthrene, 3-	3-Methylphenanthrene	832713	Organics	PAHs	SVOCs	LMW_PAH			2014-12-08
Methylphenanthrene, 3/4-	3/4-Methylphenanthrene	0	Organics	PAHs					2014-12-23
Methylphenanthrene, 9/4-	9/4-Methylphenanthrene	0	Organics	PAHs	SVOCs	LMW_PAH			2014-12-08
Methylphenanthrene-d10, 2-(Surrogate)	Surrogate: 2-Methylphenanthrene-d10	0	Organics	PAHs					2012-04-04
Methylphenol, 2-	2-Methylphenol	95487	Organics	SVOCs	Phenols	non-Chlorinated Phenols			2007-07-27
Methylphenol, 2-(Surrogate)	Surrogate: 2-Methylphenol	0	Organics	SVOCs					2016-05-20
Methylphenol, 3-	3-Methylphenol	0	Organics	SVOCs					2016-05-20
Methylphenol, 3/4-	3-Methylphenol/4-Methylphenol	106445	Organics	SVOCs	Phenols	non-Chlorinated Phenols			2007-07-27
Methylphenol, 3/4-(Surrogate)	Surrogate: 3-Methylphenol/4-Methylphenol	0	Organics	SVOCs					2016-05-20
Methylphenol, 4-	4-Methylphenol	0	Organics	SVOCs					2016-05-20
Methylprednisolone	Methylprednisolone	83432	Organics	PPCPs					2010-04-26
Methylprednisolone-d2(Surrogate)	Surrogate: Methylprednisolone-d2	0	Organics	PPCPs					2010-04-26
Methylprednisolone-d3(Surrogate)	Surrogate: Methylprednisolone-d3	0	Organics	PPCPs					2018-01-29
Methylpyridine, 2-	2-Methylpyridine	0	Organics	VOCs					2014-02-05
Metiram	Metiram	0	Organics	Pesticides	Fungicides				2017-04-04
Metolachlor	Metolachlor	51218452	Organics	Herbicides					2007-07-27
Metolachlor ethanesulfonic acid	Metolachlor ethanesulfonic acid	171118095	Organics	Pesticides					2017-04-20
Metolachlor oxanilic acid	Metolachlor oxanilic acid	0	Organics	Pesticides					2017-04-20
Metolachlor, S-	S-Metolachlor	87392129	Organics	Pesticides					2019-06-13
Metolachlor-13C6(Surrogate)	Surrogate: Metolachlor-13C6	0	Organics						2022-10-27
Metoprolol	Metoprolol	51384511	Organics	PPCPs					2010-04-26
Metoprolol-d7(Surrogate)	Surrogate: Metoprolol-d7	0	Organics	PPCPs					2010-04-26
Metribuzin	Metribuzin	21087649	Organics	Herbicides					2007-07-27
Metsulfuron Methyl	Metsulfuron Methyl	74223646	Organics	Herbicides					2013-05-20
Mevinphos	Mevinphos (Phosdrin)	7786347	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Mexacarbate	Mexacarbate	315184	Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
MGK 264	MGK 264 (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide)	0							2017-01-12
MGK 264-A	MGK 264 Peak A (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide)	113484	Organics	Pesticides					2018-08-07
MGK 264-B	MGK 264 Peak B (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide)	113484	Organics	Pesticides					2018-08-07
Miconazole	Miconazole	22916478	Organics	PPCPs					2010-04-26
Microalgae Thickness	Thickness of microalgae (if present) at a point along a transect	0	Habitat						2008-12-04
Microcystin-[Dha7]LR	Microcystin-[dehydroalanine7]LR	0							2019-03-21
Microcystin-[DLeu1]LR	Microcystin-[deleucine1]LR	0							2019-03-21
Microcystin-HilR	Microcystin- homoisoleucineR	0							2019-03-21
Microcystin-HtyR	Microcystin-homotyrosineR	0							2019-03-21
Microcystin-LA	Microcystin-LA (MCY-LA)	96180799	Microbiological	Cyanotoxins					2013-05-28
Microcystin-LF	Microcystin-LF (MCY-LF)	154037704	Microbiological	Cyanotoxins					2013-05-28
Microcystin-LR	Microcystin-LR (MCY-LR)	101043372	Microbiological	Cyanotoxins					2013-05-28
Microcystin-LW	Microcystin-LW (MCY-LW)	157622021	Microbiological	Cyanotoxins					2013-05-28
Microcystin-LY	Microcystin-LY (MCY-LY)	123304109	Microbiological	Cyanotoxins					2013-05-28
Microcystin-RR	Microcystin-RR (MCY-RR)	111755374	Microbiological	Cyanotoxins					2013-05-28
Microcystins, Total	Total Microcystins	0	Microbiological	Cyanotoxins					2014-03-07
Microcystin-WR	Microcystin-WR (MCY-WR)	0							2019-03-21
Microcystin-YR	Microcystin-YR (MCY-YR)	101064486	Microbiological	Cyanotoxins					2013-05-28
Military Land Extent	Military Land Extent	0	Habitat						2019-05-07
Military Land Intensity	Military Land Intensity	0	Habitat						2019-05-07
Military Land Proximity	Military Land Proximity	0	Habitat						2019-05-07
Milk Carton	Milk Carton	0	Debris	Trash	Plastics	FoodService			2014-11-04
Mines, Quaries	Mines, Quaries	0	Habitat						2009-08-20
Mining Extent	Mining Extent	0	Habitat						2019-05-07
Mining Intensity	Mining Intensity	0	Habitat						2019-05-07
Mining Proximity	Mining Proximity	0	Habitat						2019-05-07
Mirex	Mirex	2385855	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
Mirex(Surrogate)	Surrogate: Mirex	2385855	Organics	Pesticides					2013-06-17
Mirex-13C10(Surrogate)	Surrogate: Mirex-13C10	0	Organics	Pesticides					2014-01-28
Miscellaneous	Miscellaneous using Trash Protocol	0	Trash						2011-05-04
Miscellaneous, Other	Miscellaneous, Other	0	Debris	Trash	Plastics	Miscellaneous			2014-11-04
Moisture	Moisture	0	Organics	Inorganics	Conventionals				2007-07-27
Molinate	Molinate (Ordram)	2212671	Organics	Pesticides	Pest-OPs				2007-07-27
Molinate sulfoxide	Molinate sulfoxide	52236290	Organics	Pesticides					2017-04-20
Molybdenum	Molybdenum	7439987	Inorganics	Metals					2007-07-27
Molybdenum, Acid Labile	Acid Labile Molybdenum	0	Inorganics	Metals					2010-11-11
Monobromophenyl-hexachloro-norbornene-1	Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 1)	0	Organics	FlameRetardants					2015-07-16
Monobromophenyl-hexachloro-norbornene-2	Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 2)	0	Organics	FlameRetardants					2015-07-16
Monobromophenyl-hexachloro-norbornene-3	Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 3)	0	Organics	FlameRetardants					2015-07-16
Monobutyltin as Sn	Monobutyltin as Sn (MBT)	78763549	Organics	Organotins	Biocide				2010-06-21
Monocrotophos	Monocrotophos	6923224	Organics	Pesticides	Insecticides	Organophosphorous			2014-01-28
Mono-dechlorinated Dechlorane Plus	Mono-dechlorinated Dechlorane Plus (C11-DP)	0	Organics	FlameRetardants					2014-03-13
Monomethyl tetrachloroterephthalate	Monomethyl tetrachloroterephthalate (MTP)	887547	Organics	Pesticides					2017-04-10
Monomethylarsonic Acid	Monomethylarsonic Acid	0	Inorganics	Metals					2014-01-29
Monuron	Monuron	150685	Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Monuron(Surrogate)	Surrogate: Monuron	150685							2016-12-21
Monuron-TCA	Monuron-TCA	140410	Organics	Pesticides					2017-04-20
Morphine	Morphine	57272							2021-05-07
Mortality/Abnormality	Mortality/Abnormality (%)	0	Toxicity						2007-07-27
Mortality/Normality	Mortality/Normality (%)	0	Toxicity						2007-07-27
Motor Oil	Motor Oil	0	Organics	PAHs					2014-01-28
Mountain Bikes Extent	Mountain Bikes Extent	0	Habitat						2019-05-07
Mountain Bikes Intensity	Mountain Bikes Intensity	0	Habitat						2019-05-07
Mountain Bikes Proximity	Mountain Bikes Proximity	0	Habitat						2019-05-07
Mowing/Cutting Extent	Mowing/Cutting Extent	0	Habitat						2019-05-07
Mowing/Cutting Intensity	Mowing/Cutting Intensity	0	Habitat						2019-05-07
Mowing/Cutting Proximity	Mowing/Cutting Proximity	0	Habitat						2019-05-07
Musk Ambrette	Musk Ambrette	0	Organics	Musk					2013-05-29
Musk Ketone	Musk Ketone	0	Organics	Musk					2013-05-29
Musk Moskene	Musk Moskene	0	Organics	Musk					2013-05-29
Musk Xylene	Musk Xylene	0	Organics	Musk					2013-05-29
Mutagenicity	Mutagenicity	0	Toxicity						2007-07-27
Myclobutanil	Myclobutanil	88671890	Organics	Fungicides					2016-05-20
N,N-Diethyl-3-methyl-benzamide-d7(Surrogate)	Surrogate: N,N-Diethyl-3-methyl-benzamide-d7	0	Organics	PPCPs					2013-05-30
N,N-Diethyl-3-methyl-benzamide-d7, N,N-(Surrogate)	Surrogate: N,N-Diethyl-3-methyl-benzamide-d7	0	Organics	PPCPs					2013-05-29
Nabam	Nabam	0	Organics	Pesticides	Fungicides				2017-04-04
Nail/Screw/Bolt	Nail/Screw/Bolt	0	Debris	Trash	Non-Plastics	Metals			2014-11-04
Naled	Naled (Dibrom)	300765	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Naphthalene	Naphthalene	91203	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Naphthalene-d8(Surrogate)	Surrogate: Naphthalene-d8	1146652	Organics	PAHs	SVOCs	Insecticides			2007-07-27
Naphthalenes, C1-	C1-Naphthalenes	0	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Naphthalenes, C2-	C2-Naphthalenes	0	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Naphthalenes, C3-	C3-Naphthalenes	0	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Naphthalenes, C4-	C4-Naphthalenes	0	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Naphthobenzothiophene	Naphthobenzothiophene	0	Organics	PAHs					2014-01-28
Naphthobenzothiophene, C1-	C1-Naphthobenzothiophene	0	Organics	PAHs					2014-01-28
Naphthobenzothiophene, C2-	C2-Naphthobenzothiophene	0	Organics	PAHs					2014-01-28
Naphthobenzothiophene, C3-	C3-Naphthobenzothiophene	0	Organics	PAHs					2014-01-28
Naphthylamine, 2-	2-Naphthylamine	0							2017-11-08
Napropamide	Napropamide	15299997	Organics	Pesticides	Herbicides				2013-05-28
Naproxen	Naproxen	22204531	Organics	PPCPs					2010-04-26
Naproxen-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Naproxen-d3	958293771	Organics						2022-07-22
Naproxen-d3-13C(Surrogate)	Surrogate: Naproxen-d3-13C	0	Organics	PPCPs					2010-04-26
Naptalam, sodium salt	Naptalam, sodium salt	132672	Organics	Pesticides					2017-04-10
Napthalene	Napthalene	0	Organics						2016-12-21
Natural, cotton/wool	Natural, cotton/wool	0	Debris	Trash	Non-Plastics	Biodegradable			2014-11-04
Neburon	Neburon	555373	Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Neodymium	Neodymium	7440008	Inorganics						2013-05-20
Nest	Nest (%)	0	Toxicity						2007-07-27
Nickel	Nickel	7440020	Inorganics	TraceElements	Metals				2007-07-27
Nicosulfuron	Nicosulfuron	111991094	Organics	Herbicides					2013-05-20
NID as CTAS	4-Nitro-Inden-1-One (NID) as Cobalt Thiocyanate Active Substances (CTAS)	0							2016-12-23
Nifedipine	Nifedipine	21829254							2021-05-07
Niobium	Niobium	7440031	Inorganics						2013-05-20
Nitenpyram	Nitenpyram	120738898	Organics	Pesticides	Insecticides	Neonics			2017-10-05
Nitralin	Nitralin	0	Organics	Pesticides	Herbicides				2017-04-04
Nitrapyrin	Nitrapyrin	0	Organics	Pesticides					2017-04-04
Nitrate + Nitrite as N	Nitrate + Nitrite as N	0	Inorganics	Conventionals	Nutrients				2013-05-28
Nitrate as N	Nitrate as N	14797558	Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			2007-07-27
Nitrate as NO3	Nitrate as Nitrate	14797558	Inorganics	Conventionals					2016-05-20
Nitrite as N	Nitrite as N	14797650	Inorganics	Conventionals	Nutrients				2007-07-27
Nitroaniline, 2-	2-Nitroaniline	88744	Organics	SVOCs					2007-07-27
Nitroaniline, 3-	3-Nitroaniline	99092	Organics	SVOCs					2007-07-27
Nitroaniline, 4-	4-Nitroaniline	100016	Organics	SVOCs					2007-07-27
Nitrobenzene	Nitrobenzene	98953	Organics	VOCs					2007-07-27
Nitrobenzene-d5(Surrogate)	Surrogate: Nitrobenzene-d5	4165600	Organics	VOCs					2016-03-02
Nitrofen	Nitrofen	0	Organics	Pesticides	Herbicides				2017-04-04
Nitrogen Oxide	Nitrogen Oxide	10102439	Inorganics	Conventionals					2014-01-22
Nitrogen, Inorganic	Inorganic Nitrogen as N	0	Inorganics						2012-10-29
Nitrogen, Organic	Organic Nitrogen as N	7727379	Inorganics	Conventionals	Nutrients				2012-01-11
Nitrogen, Total	Total Nitrogen	0	Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			2011-11-10
Nitrogen, Total Kjeldahl	Total Kjeldahl Nitrogen (TKN)	7727379	Inorganics	Conventionals	Nutrients				2007-07-27
Nitrogen-15	Nitrogen-15	29817796	Organics	Radiochemistry					2014-11-05
Nitrogen-15/Nitrogen-14 Ratio	Nitrogen-15/Nitrogen-14 Ratio (Delta 15N nitrate isotope)	0							2019-03-26
Nitrophenol, 2-	2-Nitrophenol	88755	Organics	SVOCs	Phenols	non-Chlorinated Phenols			2007-07-27
Nitrophenol, 2-(Surrogate)	Surrogate: 2-Nitrophenol	0	Organics	SVOCs					2016-05-20
Nitrophenol, 4-	4-Nitrophenol	100027	Organics	SVOCs	Phenols	non-Chlorinated Phenols			2007-07-27
Nitrophenol, 4-(Surrogate)	Surrogate: 4-Nitrophenol	0	Organics	SVOCs					2016-05-20
Nitrosodiethylamine, N-	N-Nitrosodiethylamine	0	Organics	VOCs					2017-03-29
Nitrosodimethylamine, N-	N-Nitrosodimethylamine	0	Organics	SVOCs					2014-01-29
Nitrosodimethylamine-d6, N-(Surrogate)	Surrogate: N-Nitrosodimethylamine-d6	0	Organics	SVOCs					2017-03-29
Nitrosodi-n-propylamine, N-	N-Nitrosodi-n-propylamine	621647	Organics	SVOCs					2007-07-27
Nitrosodiphenylamine, N-	N-Nitrosodiphenylamine	0	Organics	SVOCs					2014-01-29
Nitrosomethylethylamine, N-	N-Nitrosomethylethylamine	0	Organics	SVOCs					2017-03-29
No Debris Collected	No Debris Collected	0	Debris	Trash	Survey				2014-11-04
No Debris Present	No Debris Present	0	Debris	Trash	Survey				2014-11-04
Nodularin	Nodularin	118399227	Microbiological	Cyanotoxins					2012-05-22
NoItems	Number of Items using Trash Protocol	0	Trash						2011-05-04
Nonachlor, cis-	cis-Nonachlor	5103731	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2007-07-27
Nonachlor, cis-(Surrogate)	Surrogate: cis-Nonachlor	0	Organics	Pesticides					2008-11-17
Nonachlor, trans-	trans-Nonachlor	39765805	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2007-07-27
Nonachlor, trans-(Surrogate)	Surrogate: trans-Nonachlor	0	Organics	Pesticides					2008-11-17
Nonacosane, n-	n-Nonacosane	630035	Organics	Alkanes					2013-05-01
Nonadecane, n-	n-Nonadecane	629925	Organics	Alkanes					2013-05-01
Nonane	Nonane (C9)	111842	Organics						2017-05-03
Nonane(Surrogate)	Surrogate: Nonane	111842	Organics						2017-08-10
None	Used for non-treated samples	0	WaterQualityMeasurements	ToxTreatment					2007-07-27
NonPoint Source Discharges Stormwater Extent	NonPoint Source Discharges Stormwater Extent	0	Habitat						2019-05-07
NonPoint Source Discharges Stormwater Intensity	NonPoint Source Discharges Stormwater Intensity	0	Habitat						2019-05-07
NonPoint Source Discharges Stormwater Proximity	NonPoint Source Discharges Stormwater Proximity	0	Habitat						2019-05-07
Nonylphenol	Nonylphenol	25154523	Organics	Surfactants	Phenols	non-Chlorinated Phenols			2007-07-27
Nonylphenol diethoxylate	Nonylphenol diethoxylate	20427843							2021-05-07
Nonylphenol Diethoxylate, 4-	4-Nonylphenol Diethoxylate	0	Organics	PPCPs					2013-05-29
Nonylphenol Diethoxylate, 4-(Surrogate)	Surrogate: 4-Nonylphenol Diethoxylate	20427843							2020-09-04
Nonylphenol diethoxylate, tech-	tech-Nonylphenol diethoxylate	0							2021-01-14
Nonylphenol Diethoxylate-13C6, 4-(Surrogate)	Surrogate: 4-Nonylphenol Diethoxylates-13C6	0	Organics	PPCPs					2013-05-29
Nonylphenol monoethoxylate	Nonylphenol monoethoxylate	0							2021-01-14
Nonylphenol Monoethoxylate, 4-	4-Nonylphenol Monoethoxylate	0	Organics	PPCPs					2013-05-29
Nonylphenol monoethoxylate, 4-n-	4-n-Nonylphenol monoethoxylate	104358							2022-02-11
Nonylphenol Monoethoxylate-13C6, 4-(Surrogate)	Surrogate: 4-Nonylphenol Monoethoxylate-13C6	0	Organics	PPCPs					2013-05-29
Nonylphenol, 4-n-	4-n-Nonylphenol	104405	Organics	Surfactants					2016-05-20
Nonylphenol, p-	p-Nonylphenol	0	Organics	Surfactants	Phenols				2011-05-11
Nonylphenol, tech-	tech-Nonylphenol (Branched p-nonylphenol)	84852153	Organics	Surfactants					2016-05-20
Nonylphenol-13C6, 4-n-(Surrogate)	Surrogate: 4-n-Nonylphenol-13C6	0	Organics	PPCPs					2013-06-25
Nonylphenol-13C6, n-4-(Surrogate)	Surrogate: 4-n-Nonylphenol-13C6	0	Organics	PPCPs					2010-04-26
Nonylphenol-d4, 4-(Surrogate)	Surrogate: 4-Nonylphenol-d4	1173019629	Organics						2020-06-26
Nonylphenolethoxylate	Nonylphenolethoxylate	9016459	Organics	Surfactants	Phenols	non-Chlorinated Phenols			2007-07-27
Norethisterone	Norethisterone	68224							2021-05-07
Norfloxacin	Norfloxacin	70458967	Organics	PPCPs					2010-04-26
Norfluoxetine	Norfluoxetine	126924387	Organics	PPCPs					2010-04-26
Norfluoxetine-d5(Surrogate)	Surrogate: Norfluoxetine-d5	0	Organics	PPCPs					2010-04-26
Norflurazon	Norflurazon (3(2H)-Pyridazinone, 4-chloro-5-(methylamino)-2-[3-(trifluoromethyl)phenyl]-) (Telok)	27314132	Organics	Pesticides	Herbicides				2013-05-20
Norgestimate	Norgestimate	35189287	Organics	PPCPs					2010-04-26
Normal Development	Normal Development (%)	0	Toxicity						2007-07-27
Norverapamil	Norverapamil	67018853	Organics	PPCPs					2010-04-26
Not Characterized Fiber	Fiber particle not attempted to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown				1900-01-01
Not Characterized Fiber Bundle	Fiber bundle particle not attempted to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown				1900-01-01
Not Characterized Film	Film particle not attempted to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown				1900-01-01
Not Characterized Foam	Foam particle not attempted to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown				1900-01-01
Not Characterized Fragment	Fragment particle not attempted to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown				1900-01-01
Not Characterized Sphere	Sphere particle not attempted to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown				1900-01-01
Novaluron	Novaluron	116714466	Organics	Pesticides	Herbicides				2016-03-10
Noxious Chemical Odors Extent	Noxious Chemical Odors Extent	0	Habitat						2019-05-07
Noxious Chemical Odors Intensity	Noxious Chemical Odors Intensity	0	Habitat						2019-05-07
Noxious Chemical Odors Proximity	Noxious Chemical Odors Proximity	0	Habitat						2019-05-07
Nutrient Related Water Other Extent	Nutrient Related Water Other Extent	0	Habitat						2019-05-07
Nutrient Related Water Other Intensity	Nutrient Related Water Other Intensity	0	Habitat						2019-05-07
Nutrient Related Water Other Proximity	Nutrient Related Water Other Proximity	0	Habitat						2019-05-07
NutrientSpike	Combination of multiple nutrients; see tox test comments for specific analytes and concentrations	0	Tox Treatment						2021-08-20
Nylon Fiber	Nylon Fiber	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Nylon Film	Nylon Film	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Nylon Foam	Nylon Foam	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Nylon Fragment	Nylon Fragment	0	Microdebris	Anthropogenic	Plastic				1900-01-01
Nylon Sphere	Nylon Sphere	0	Microdebris	Anthropogenic	Plastic				1900-01-01
O,O,O-Triethyl phosphorothioate	O,O,O-Triethyl phosphorothioate	0							2017-01-12
ObservedChannelFlowLevel	ObservedChannelFlowLevel	0	FieldObservations	Habitat					2011-05-31
ObservedFlow	ObservedFlow	0	FieldObservations	Habitat					2009-08-20
Obstructions (culverts, paved stream crossings) Extent	Obstructions (culverts, paved stream crossings) Extent	0	Habitat						2019-05-07
Obstructions (culverts, paved stream crossings) Intensity	Obstructions (culverts, paved stream crossings) Intensity	0	Habitat						2019-05-07
Obstructions (culverts, paved stream crossings) Proximity	Obstructions (culverts, paved stream crossings) Proximity	0	Habitat						2019-05-07
OCDD, 1,2,3,4,6,7,8,9-	1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD)	3268879	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
OCDD, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD)	3268879	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
OCDD-13C, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin-13C (OCDD)	0	Organics	DioxinsDibenzofurans					2013-06-05
OCDF, 1,2,3,4,6,7,8,9-	1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF)	39001020	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
OCDF, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF)	39001020	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
OCDF-13C, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran-13C (OCDF)	0	Organics	DioxinsDibenzofurans					2013-06-05
Octabromo-1,3,3-trimethyl-1-phenylindane	Octabromo-1,3,3-trimethyl-1-phenylindane (OBIND)	155613937	Organics	FlameRetardants					2014-03-13
Octachlorostyrene	Octachlorostyrene	0	Organics	VOCs					2014-01-29
Octachlorostyrene-13C8(Surrogate)	Surrogate: Octachlorostyrene-13C8	0	Organics	VOCs					2014-01-29
Octacosane, n-	n-Octacosane	0	Organics	Alkanes					2014-01-28
Octacosane, n-(Surrogate)	Surrogate: n-Octacosane	0	Organics	Alkanes					2016-10-31
Octadecane, n-	n-Octadecane	0	Organics	Alkanes					2014-01-28
Octamethylcyclotetrasiloxane	Octamethylcyclotetrasiloxane	556672							2021-05-19
Octyl bicycloheptene dicarboximide, N-	N-Octyl bicycloheptene dicarboximide	0	Organics	Pesticides					2017-04-04
Octylammonium Methanearsonate	Octylammonium Methanearsonate	0	Organics	Pesticides	Herbicides				2017-04-04
Octylphenol	Octylphenol	0	Organics	PPCPs					2010-04-26
Octylphenol diethoxylate, 4-n-	4-n-Octylphenol diethoxylate	51437902							2021-05-07
Octylphenol diethoxylate, tert-4-	4-tert-Octylphenol diethoxylate (OP2EO)	2315619	Organics	Phenols					2018-07-18
Octylphenol monoethoxylate, 4-	4-Octylphenol monoethoxylate	0							2021-01-14
Octylphenol monoethoxylate, 4-n-	4-n-Octylphenol monoethoxylate	51437899							2022-02-11
Octylphenol monoethoxylate, tert-4-	4-tert-Octylphenol monoethoxylate (OP1EO)	2315675	Organics	Phenols					2018-07-18
Octylphenol, 4-	4-Octylphenol	1806264							2018-08-31
Octylphenol, 4-n-	4-n-Octylphenol	1806264							2022-02-11
Octylphenol, tert-4-	4-tert-Octylphenol	140669	Organics	Phenols					2018-07-18
Odor	Odor	0	FieldObservations	Habitat					2009-08-20
Odor Intensity	Odor Intensity - Specific to EMAP BA (characterizes intensity of odor)	0	Habitat						2009-08-20
Offspring	Offspring (#)	0	Toxicity						2007-07-27
Ofloxacin	Ofloxacin	82419361	Organics	PPCPs					2010-04-26
Oil, Gas Wells	Oil, Gas Wells	0	Habitat						2009-08-20
OilandGrease; FOG-HEM	Oil and Grease; Fats, Oils and Grease N-Hexane Extractable Material (Polar Material)	0	Inorganics						2018-07-05
OilandGrease; HEM	Oil and Grease, N-Hexane Extractable Material	0	Organics	PAHs					2013-09-24
OilandGrease; SGT-HEM	Oil and Grease, Silica Gel Treated N-Hexane Extractable Material (Non-Polar Material Not Adsorbed by Silica Gel)	0	Organics	PAHs					2013-09-24
Okadaic Acid	Okadaic Acid	78111178	Microbiological	Cyanotoxins					2013-05-28
Omethoate	Omethoate	0	Organics	Pesticides	Insecticides				2017-04-04
Open Shell Volume	Open Shell Volume (weight (in grams) of water displaced by each empty bivalve)	0	Organics	Inorganics	Metals	Conventionals			2012-11-08
Orchards	Orchards	0	Habitat						2009-08-20
Orchards Extent	Orchards Extent	0	Habitat						2019-05-07
Orchards Intensity	Orchards Intensity	0	Habitat						2019-05-07
Orchards Proximity	Orchards Proximity	0	Habitat						2019-05-07
Organic natural material	Hair or other unprocessed natural fiber, fragment, film	0	Microdebris	Natural	Natural	Natural			2018-04-26
Organic Natural Material Fiber	Organic natural material Fiber	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Organic Natural Material Film	Organic natural material Film	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Organic Natural Material Foam	Organic natural material Foam	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Organic Natural Material Fragment	Organic natural material Fragment	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Organic Natural Material Sphere	Organic natural material Sphere	0	Microdebris	Non-Anthropogenic	Non-Plastic				1900-01-01
Ormetoprim	Ormetoprim	0	Organics	PPCPs					2010-04-26
OrthoPhosphate as P	Reactive Phosphorous (PO4)	14265442	Inorganics	Conventionals	Nutrients				2007-07-27
Oryzalin	Oryzalin (Rycelan) (Ryzelan) (Surflan)	19044883	Organics	Herbicides					2013-05-20
Osmoregulation	Osmoregulation	0	Toxicity						2007-07-27
o-Terphenyl(Surrogate)	Surrogate: o-Terphenyl	84151	Organics	SVOCs					2016-03-02
OtherPresence	OtherPresence	0	FieldObservations	Habitat					2009-08-20
Outfall Accessibility	Outfall Accessibility	0							2016-06-13
Outfall Structural Cond	Structural condition of the outfall	0							2016-06-17
Outfall, Distance from Transect	Outfall, Distance from Transect	0	Habitat	Debris					2014-11-04
Outfall, Within Transect	Outfall, Within Transect	0	Habitat	Debris					2014-11-04
OverlandRunoffLast24hrs	Influence of overland runoff during last 24 hours	0	FieldObservations	Habitat			Constituents		2011-02-09
Oxacillin	Oxacillin	66795	Organics	PPCPs					2010-04-26
Oxadiazon	Oxadiazon	19666309	Organics	Pesticides	Pest-OCHs				2007-07-27
Oxamyl	Oxamyl	23135220	Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
Oxathiapiprolin	Oxathiapiprolin	1003318679	Organics	Pesticides	Fungicides				2018-01-03
Oxidation-Reduction Potential	Oxidation-Reduction Potential (OPR)	0	WaterQualityMeasurements	Conventionals					2016-05-20
Oxolinic Acid	Oxolinic Acid	14698294	Organics	PPCPs					2010-04-26
Oxybenzone	Oxybenzone	131577							2018-08-31
Oxycarboxin	Oxycarboxin	5259881	Organics	Pesticides					2017-04-20
Oxychlordane	Oxychlordane	27304138	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2007-07-27
Oxychlordane(Surrogate)	Surrogate: Oxychlordane	0	Organics	Pesticides					2008-11-17
Oxychlordane-13C10(Surrogate)	Surrogate: Oxychlordane-13C10	0	Organics	Pesticides					2013-06-17
Oxycodone	Oxycodone	76426	Organics	PPCPs					2010-04-26
Oxycodone-d6(Surrogate)	Surrogate: Oxycodone-d6	0	Organics	PPCPs					2010-04-26
Oxydemeton-methyl	Oxydemeton-methyl	301122	Organics	Pesticides					2017-04-20
Oxyfluorfen	Oxyfluorfen (Goal)	42874033	Organics	Pesticides	Pest-OCHs				2013-05-28
Oxygen, Dissolved	Dissolved Oxygen (DO)	0	WaterQualityMeasurements	Conventionals					2009-08-20
Oxygen, Saturation	Oxygen, Saturation	0	WaterQualityMeasurements	Conventionals					2007-07-27
Oxygen-18/Oxygen-16 Ratio	Oxygen-18/Oxygen-16 Ratio (Delta 18O nitrate isotope)	14797718	Isotopes						2013-05-20
Oxytetracycline	Oxytetracycline	79572	Organics	PPCPs					2012-05-22
Oxythioquinox	Oxythioquinox (Chinomethionate)	0	Organics	Pesticides	Fungicides				2017-04-04
Paclobutrazol	Paclobutrazol	76738620	Organics	Pesticides	Fungicides				2016-03-10
Paint Fiber	Paint Fiber	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Paint Film	Paint Film	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Paint Foam	Paint Foam	0	Microdebris	Anthropogenic	Non-Plastic				1900-01-01
Paint fragment	Paint anthropogenic fragment	0	Microdebris	Anthropogenic	Paint	Fragment			2018-04-26
Paper/Cardboard	Paper/Cardboard	0	Debris	Trash	Non-Plastics	Biodegradable			2014-11-04
PAR	Photosynthetically Active Radiation (PAR)	0	WaterQualityMeasurements						2007-07-27
Paraoxon	Paraoxon	0	Organics	Pesticides	Insecticides				2008-11-07
Paraquat	Paraquat	4685147	Organics	Pesticides	Herbicides				2013-03-14
Paraquat Bis(methylsulfate)	Paraquat Bis(methylsulfate)	0	Organics	Pesticides	Herbicides				2017-04-04
Paraquat Dichloride	Paraquat Dichloride	1910425	Organics	Pesticides	Herbicides				2013-05-28
Parathion, Ethyl	Ethyl Parathion (Parathion)	56382	Organics	Pesticides	Pest-OPs	Insecticides			2013-05-28
Parathion, Methyl	Methyl Parathion	298000	Organics	Pesticides	Pest-OPs	Insecticides			2013-05-28
Parathion, Total	Total Parathion	0							2016-12-23
Parking Lot/Pavement Extent	Parking Lot/Pavement Extent	0	Habitat						2019-05-07
Parking Lot/Pavement Intensity	Parking Lot/Pavement Intensity	0	Habitat						2019-05-07
Parking Lot/Pavement Proximity	Parking Lot/Pavement Proximity	0	Habitat						2019-05-07
Parks, Campgrounds	Parks, Campgrounds	0	Habitat						2009-08-20
Paroxetine	Paroxetine	61869087	Organics	PPCPs					2010-04-26
Paroxetine-d6(Surrogate)	Surrogate: Paroxetine-d6	0	Organics	PPCPs					2010-04-26
Particulate Organic Carbon	Particulate Organic Carbon (POC)	0	Inorganics	Conventionals					2013-05-27
Particulate Organic Hydrogen	Particulate Organic Hydrogen	0	Inorganics	Conventionals					2012-03-27
Passive Input (Construction/Erosion) Extent	Passive Input (Construction/Erosion) Extent	0	Habitat						2019-05-07
Passive Input (Construction/Erosion) Intensity	Passive Input (Construction/Erosion) Intensity	0	Habitat						2019-05-07
Passive Input (Construction/Erosion) Proximity	Passive Input (Construction/Erosion) Proximity	0	Habitat						2019-05-07
Pasture	Pasture	0	Habitat						2009-08-20
Pasture Extent	Pasture Extent	0	Habitat						2019-05-07
Pasture Intensity	Pasture Intensity	0	Habitat						2019-05-07
Pasture Proximity	Pasture Proximity	0	Habitat						2019-05-07
Paved Roads Extent	Paved Roads Extent	0	Habitat						2019-05-07
Paved Roads Intensity	Paved Roads Intensity	0	Habitat						2019-05-07
Paved Roads Proximity	Paved Roads Proximity	0	Habitat						2019-05-07
PBB 001	Polybrominated Biphenyl (PBB) 1	0	Organics	FlameRetardants					2012-03-29
PBB 002	Polybrominated Biphenyl (PBB) 2	0	Organics	FlameRetardants					2012-03-29
PBB 003	Polybrominated Biphenyl (PBB) 3	0	Organics	FlameRetardants					2012-03-29
PBB 004	Polybrominated Biphenyl (PBB) 4	0	Organics	FlameRetardants					2012-03-29
PBB 007	Polybrominated Biphenyl (PBB) 7	0	Organics	FlameRetardants					2012-03-29
PBB 009	Polybrominated Biphenyl (PBB) 9	0	Organics	FlameRetardants					2012-03-29
PBB 010	Polybrominated Biphenyl (PBB) 10	0	Organics	FlameRetardants					2012-03-29
PBB 015	Polybrominated Biphenyl (PBB) 15	0	Organics	FlameRetardants					2012-03-29
PBB 018	Polybrominated Biphenyl (PBB) 18	0	Organics	FlameRetardants					2012-03-29
PBB 026	Polybrominated Biphenyl (PBB) 26	0	Organics	FlameRetardants					2012-03-29
PBB 030	Polybrominated Biphenyl (PBB) 30	0	Organics	FlameRetardants					2012-03-29
PBB 031	Polybrominated Biphenyl (PBB) 31	0	Organics	FlameRetardants					2012-03-29
PBB 049	Polybrominated Biphenyl (PBB) 49	0	Organics	FlameRetardants					2012-03-29
PBB 052	Polybrominated Biphenyl (PBB) 52	0	Organics	FlameRetardants					2012-03-29
PBB 053	Polybrominated Biphenyl (PBB) 53	0	Organics	FlameRetardants					2012-03-29
PBB 077	Polybrominated Biphenyl (PBB) 77	0	Organics	FlameRetardants					2012-03-29
PBB 080	Polybrominated Biphenyl (PBB) 80	0	Organics	FlameRetardants					2012-03-29
PBB 103	Polybrominated Biphenyl (PBB) 103	0	Organics	FlameRetardants					2012-03-29
PBB 155	Polybrominated Biphenyl (PBB) 155	0	Organics	FlameRetardants					2012-03-29
PBDE 001	Polybrominated Diphenyl Ether (PBDE) 1	0	Organics	FlameRetardants					2010-07-14
PBDE 001(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 1	0	Organics	FlameRetardants					2010-07-14
PBDE 002	Polybrominated Diphenyl Ether (PBDE) 2	0	Organics	FlameRetardants					2010-07-14
PBDE 003	Polybrominated Diphenyl Ether (PBDE) 3	0	Organics	FlameRetardants					2010-07-14
PBDE 003(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 3	0	Organics	FlameRetardants					2010-07-14
PBDE 004(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 4	0	Organics	FlameRetardants					2010-07-14
PBDE 007	Polybrominated Diphenyl Ether (PBDE) 7	0	Organics	FlameRetardants					2010-07-14
PBDE 008	Polybrominated Diphenyl Ether (PBDE) 8	0	Organics	FlameRetardants					2010-07-14
PBDE 008/11	Polybrominated Diphenyl Ether (PBDE) 8/11	0	Organics	PBDEs	FlameRetardants				2017-05-04
PBDE 010	Polybrominated Diphenyl Ether (PBDE) 10	0	Organics	FlameRetardants					2010-07-14
PBDE 011	Polybrominated Diphenyl Ether (PBDE) 11	0	Organics	FlameRetardants					2010-07-14
PBDE 012	Polybrominated Diphenyl Ether (PBDE) 12	0	Organics	FlameRetardants					2010-07-14
PBDE 012/13	Polybrominated Diphenyl Ether (PBDE) 12/13	0	Organics	PBDEs	FlameRetardants				2017-05-04
PBDE 013	Polybrominated Diphenyl Ether (PBDE) 13	0	Organics	FlameRetardants					2010-07-14
PBDE 015	Polybrominated Diphenyl Ether (PBDE) 15	0	Organics	FlameRetardants					2010-07-14
PBDE 015(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 15	0	Organics	FlameRetardants					2010-07-14
PBDE 017	Polybrominated Diphenyl Ether (PBDE) 17	49690940	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 017/25	Polybrominated Diphenyl Ether (PBDE) 17/25	0	Organics	PBDEs	FlameRetardants				2013-06-25
PBDE 019(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 19	0	Organics	FlameRetardants					2010-07-14
PBDE 025	Polybrominated Diphenyl Ether (PBDE) 25	0	Organics	FlameRetardants					2010-07-14
PBDE 028	Polybrominated Diphenyl Ether (PBDE) 28	6430906	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 028(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 28	0	Organics	FlameRetardants					2010-07-14
PBDE 028/33	Polybrominated Diphenyl Ether (PBDE) 28/33	0	Organics	PBDEs	FlameRetardants				2013-06-25
PBDE 028-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 028-13C12	0	Organics						2022-02-24
PBDE 028-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 28-13C12	0	Organics	PBDEs					2021-08-20
PBDE 030	Polybrominated Diphenyl Ether (PBDE) 30	0	Organics	FlameRetardants					2010-07-14
PBDE 032	Polybrominated Diphenyl Ether (PBDE) 32	0	Organics	FlameRetardants					2010-07-14
PBDE 033	Polybrominated Diphenyl Ether (PBDE) 33	0	Organics	FlameRetardants					2010-07-14
PBDE 033(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 33	0	Organics	FlameRetardants					2014-01-28
PBDE 035	Polybrominated Diphenyl Ether (PBDE) 35	0	Organics	FlameRetardants					2010-07-14
PBDE 037	Polybrominated Diphenyl Ether (PBDE) 37	0	Organics	FlameRetardants					2010-07-14
PBDE 037(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 37	0	Organics	FlameRetardants					2010-07-14
PBDE 047	Polybrominated Diphenyl Ether (PBDE) 47	5436431	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 047(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 47	5436431	Organics	FlameRetardants					2010-07-14
PBDE 047-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 047-13C12	0	Organics						2022-02-24
PBDE 047-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 47-13C12	0	Organics	PBDEs					2021-08-20
PBDE 049	Polybrominated Diphenyl Ether (PBDE) 49	0	Organics	FlameRetardants					2010-07-14
PBDE 049/71	Polybrominated Diphenyl Ether (PBDE) 49/71	0	Organics	SVOCs					2016-05-20
PBDE 051	Polybrominated Diphenyl Ether (PBDE) 51	0	Organics	FlameRetardants					2010-07-14
PBDE 052(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 52	0	Organics	FlameRetardants					2010-07-14
PBDE 054(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 54	0	Organics	FlameRetardants					2011-05-11
PBDE 066	Polybrominated Diphenyl Ether (PBDE) 66	84303457	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 069-F(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 69-F	0	Organics	FlameRetardants					2011-05-11
PBDE 071	Polybrominated Diphenyl Ether (PBDE) 71	0	Organics	FlameRetardants					2010-07-14
PBDE 075	Polybrominated Diphenyl Ether (PBDE) 75	0	Organics	FlameRetardants					2010-07-14
PBDE 077	Polybrominated Diphenyl Ether (PBDE) 77	0	Organics	FlameRetardants					2010-07-14
PBDE 077(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 77	0	Organics	FlameRetardants					2010-07-14
PBDE 079	Polybrominated Diphenyl Ether (PBDE) 79	0	Organics	FlameRetardants					2010-07-14
PBDE 081(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 81	0	Organics	FlameRetardants					2010-07-14
PBDE 085	Polybrominated Diphenyl Ether (PBDE) 85	182346210	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 099	Polybrominated Diphenyl Ether (PBDE) 99	60348609	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 099(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 99	0	Organics	FlameRetardants					2010-07-14
PBDE 099-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 099-13C12	0	Organics						2022-02-24
PBDE 099-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 99-13C12	0	Organics	PBDEs					2021-08-20
PBDE 100	Polybrominated Diphenyl Ether (PBDE) 100	97038976	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 100(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 100	0	Organics	FlameRetardants					2008-11-17
PBDE 100-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 100-13C12	0	Organics						2022-02-24
PBDE 100-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-13C12	0	Organics	PBDEs					2021-08-20
PBDE 100-L(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-Labeled	0	Organics	PBDEs	FlameRetardants				2011-11-29
PBDE 104(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 104	0	Organics	FlameRetardants					2008-11-17
PBDE 105	Polybrominated Diphenyl Ether (PBDE) 105	0	Organics	FlameRetardants					2008-11-17
PBDE 105(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 105	0	Organics	FlameRetardants					2008-11-17
PBDE 111(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 111	0	Organics	FlameRetardants					2008-11-17
PBDE 114(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 114	0	Organics	FlameRetardants					2008-11-17
PBDE 116	Polybrominated Diphenyl Ether (PBDE) 116	0	Organics	FlameRetardants					2008-11-17
PBDE 118	Polybrominated Diphenyl Ether (PBDE) 118	0	Organics	FlameRetardants					2012-04-03
PBDE 118(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 118	0	Organics	FlameRetardants					2008-11-17
PBDE 119	Polybrominated Diphenyl Ether (PBDE) 119	0	Organics	FlameRetardants					2008-11-17
PBDE 119/120	Polybrominated Diphenyl Ether (PBDE) 119/120	0	Organics	PBDEs	FlameRetardants				2017-05-04
PBDE 120	Polybrominated Diphenyl Ether (PBDE) 120	0	Organics	FlameRetardants					2008-11-17
PBDE 123(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 123	0	Organics	FlameRetardants					2008-11-17
PBDE 126	Polybrominated Diphenyl Ether (PBDE) 126	0	Organics	FlameRetardants					2008-11-17
PBDE 126(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 126	0	Organics	FlameRetardants					2008-11-17
PBDE 128	Polybrominated Diphenyl Ether (PBDE) 128	0	Organics	FlameRetardants					2008-11-17
PBDE 138	Polybrominated Diphenyl Ether (PBDE) 138	67888986	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 138(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 138	0	Organics	FlameRetardants					2009-08-14
PBDE 138/166	Polybrominated Diphenyl Ether (PBDE) 138/166	0	Organics	PBDEs	FlameRetardants				2017-05-04
PBDE 139	Polybrominated Diphenyl Ether (PBDE) 139	0	Organics	FlameRetardants					2009-01-08
PBDE 139(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 139	0	Organics	FlameRetardants					2008-11-17
PBDE 139-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 139-13C12	0	Organics						2022-02-24
PBDE 139-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 139-13C12	0	Organics	PBDEs					2021-08-20
PBDE 140	Polybrominated Diphenyl Ether (PBDE) 140	0	Organics	FlameRetardants					2008-11-17
PBDE 140(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 140	0	Organics	FlameRetardants					2008-11-17
PBDE 153	Polybrominated Diphenyl Ether (PBDE) 153	68631492	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 153(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 153	0	Organics	FlameRetardants					2008-11-17
PBDE 153-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 153-13C12	0	Organics						2022-02-24
PBDE 153-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 153-13C12	0	Organics	PBDEs					2021-08-20
PBDE 154	Polybrominated Diphenyl Ether (PBDE) 154	36402150	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 154(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 154	0	Organics	FlameRetardants					2008-11-17
PBDE 154-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 154-13C12	0	Organics						2022-02-24
PBDE 154-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 154-13C12	0	Organics	PBDEs					2021-08-20
PBDE 155	Polybrominated Diphenyl Ether (PBDE) 155	0	Organics	FlameRetardants					2008-11-17
PBDE 155(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 155	0	Organics	FlameRetardants					2008-11-17
PBDE 156(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 156	0	Organics	FlameRetardants					2008-11-17
PBDE 157(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 157	0	Organics	FlameRetardants					2008-11-17
PBDE 160	Polybrominated Diphenyl Ether (PBDE) 160	0	Organics	SVOCs					2016-05-20
PBDE 166	Polybrominated Diphenyl Ether (PBDE) 166	0	Organics	FlameRetardants					2008-11-17
PBDE 167(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 167	0	Organics	FlameRetardants					2008-11-17
PBDE 169(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 169	0	Organics	FlameRetardants					2008-11-17
PBDE 170(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 170	0	Organics	FlameRetardants					2008-11-17
PBDE 172(Surrogate)	Surrogate: PBDE 172 Surrogate: PBDE 172	0							2019-06-11
PBDE 178(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 178	0	Organics	FlameRetardants					2008-11-17
PBDE 179	Polybrominated Diphenyl Ether (PBDE) 179	0	Organics	FlameRetardants					2010-11-08
PBDE 180(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 180	0	Organics	FlameRetardants					2008-11-17
PBDE 181	Polybrominated Diphenyl Ether (PBDE) 181	0	Organics	FlameRetardants					2008-11-17
PBDE 183	Polybrominated Diphenyl Ether (PBDE) 183	68928803	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 183(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 183	0	Organics	FlameRetardants					2008-11-17
PBDE 183-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 183-13C12	0	Organics						2022-02-24
PBDE 183-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 183-13C12	0	Organics	PBDEs					2021-08-20
PBDE 184	Polybrominated Diphenyl Ether (PBDE) 184	0	Organics	FlameRetardants					2010-11-08
PBDE 188	Polybrominated Diphenyl Ether (PBDE) 188	0	Organics	FlameRetardants					2010-11-08
PBDE 188(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 188	0	Organics	FlameRetardants					2008-11-17
PBDE 189(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 189	0	Organics	FlameRetardants					2008-11-17
PBDE 190	Polybrominated Diphenyl Ether (PBDE) 190	79682250	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 194	Polybrominated Diphenyl Ether (PBDE) 194	0	Organics	FlameRetardants					2012-04-03
PBDE 195	Polybrominated Diphenyl Ether (PBDE) 195	0	Organics	FlameRetardants					2012-04-03
PBDE 196	Polybrominated Diphenyl Ether (PBDE) 196	0	Organics	FlameRetardants					2009-08-14
PBDE 197	Polybrominated Diphenyl Ether (PBDE) 197	0	Organics	FlameRetardants					2009-01-08
PBDE 197(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 197	0	Organics	FlameRetardants					2009-08-14
PBDE 198	Polybrominated Diphenyl Ether (PBDE) 198	0	Organics	FlameRetardants					2012-04-03
PBDE 200	Polybrominated Diphenyl Ether (PBDE) 200	0	Organics	FlameRetardants					2010-11-08
PBDE 200/203	Polybrominated Diphenyl Ether (PBDE) 200/203	0	Organics	PBDEs	FlameRetardants				2013-06-25
PBDE 201	Polybrominated Diphenyl Ether (PBDE) 201	0	Organics	FlameRetardants					2010-11-08
PBDE 202	Polybrominated Diphenyl Ether (PBDE) 202	0	Organics	FlameRetardants					2010-11-08
PBDE 202(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 202	0	Organics	FlameRetardants					2008-11-17
PBDE 203	Polybrominated Diphenyl Ether (PBDE) 203	0	Organics	FlameRetardants					2008-11-17
PBDE 204	Polybrominated Diphenyl Ether (PBDE) 204	0	Organics	FlameRetardants					2009-01-08
PBDE 205	Polybrominated Diphenyl Ether (PBDE) 205	0	Organics	FlameRetardants					2009-01-08
PBDE 205(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 205	0	Organics	FlameRetardants					2008-11-17
PBDE 206	Polybrominated Diphenyl Ether (PBDE) 206	0	Organics	FlameRetardants					2008-11-17
PBDE 206(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 206	0	Organics	FlameRetardants					2008-11-17
PBDE 207	Polybrominated Diphenyl Ether (PBDE) 207	0	Organics	FlameRetardants					2008-11-17
PBDE 207(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 207	0	Organics	FlameRetardants					2009-08-14
PBDE 208	Polybrominated Diphenyl Ether (PBDE) 208	0	Organics	FlameRetardants					2008-11-17
PBDE 208(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 208	0	Organics	FlameRetardants					2008-11-17
PBDE 209	Polybrominated Diphenyl Ether (PBDE) 209	1163195	Organics	FlameRetardants					2008-11-17
PBDE 209(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 209	1163195	Organics	FlameRetardants					2010-07-14
PBDE 209-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 209-13C12	0	Organics						2022-02-24
PBDE 209-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 209-13C12	0	Organics	PBDEs					2021-08-20
PCB 001	PCB 1 Congener	0	Organics	PCBs					2010-07-14
PCB 001(Surrogate)	Surrogate: PCB 1 Congener	0	Organics	PCBs					2010-07-14
PCB 001-13C(IsoDilAnalogue)	Isotopic Dilution Analogue: PCB 001-13C	0							2022-07-01
PCB 001-13C(Surrogate)	Surrogate: PCB 001-13C Congener	0	Organics	PCBs					2016-05-20
PCB 002	PCB 2 Congener	0	Organics	PCBs					2010-07-14
PCB 003	PCB 3 Congener	0	Organics	PCBs					2010-07-14
PCB 003(Surrogate)	Surrogate: PCB 3 Congener	0	Organics	PCBs					2010-07-14
PCB 003-13C(IsoDilAnalogue)	Isotopic Dilution Analogue: PCB 003-13C	0							2022-07-01
PCB 003-13C(Surrogate)	Surrogate: PCB 003-13C Congener	0	Organics	PCBs					2016-05-20
PCB 004	PCB 4 Congener	0	Organics	PCBs					2010-07-14
PCB 004(Surrogate)	Surrogate: PCB 4 Congener	0	Organics	PCBs					2010-07-14
PCB 004/10	PCB 4/10 Congener	0	Organics	PCBs					2013-04-04
PCB 004-13C(IsoDilAnalogue)	Isotopic Dilution Analogue: PCB 004-13C	0							2022-07-01
PCB 004-13C(Surrogate)	Surrogate: PCB 004-13C Congener	0	Organics	PCBs					2016-05-20
PCB 005	PCB 5 Congener	16605917	Organics	PCBs	Congeners				2007-07-27
PCB 005/8	PCB 5/8 Congener	0	Organics	PCBs	Congeners				2012-05-14
PCB 006	PCB 6 Congener	25569806	Organics	PCBs	Congeners				2007-07-27
PCB 007	PCB 7 Congener	0	Organics